FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631450_at:

>probe:Drosophila_2:1631450_at:161:103; Interrogation_Position=140; Antisense; AGACCAAGGTGTTTTCCTGGGCAGT
>probe:Drosophila_2:1631450_at:68:351; Interrogation_Position=160; Antisense; GCAGTTCCCACACTTTTCTTGAATA
>probe:Drosophila_2:1631450_at:475:85; Interrogation_Position=195; Antisense; AGTGCACCAGGTCAGTAAGCCAAGC
>probe:Drosophila_2:1631450_at:201:73; Interrogation_Position=220; Antisense; AGGAACTCCTTCATTCGCAGATGCA
>probe:Drosophila_2:1631450_at:14:97; Interrogation_Position=238; Antisense; AGATGCAGCGTCAGGAACTGCTCCT
>probe:Drosophila_2:1631450_at:24:637; Interrogation_Position=298; Antisense; TCGAATCCCGAAATGCGCAAGGCAT
>probe:Drosophila_2:1631450_at:342:23; Interrogation_Position=331; Antisense; ATATGTCGGCTTACGGTGGACAACA
>probe:Drosophila_2:1631450_at:295:185; Interrogation_Position=352; Antisense; AACAAGTGGCTGTTTATTTGCGGCA
>probe:Drosophila_2:1631450_at:185:19; Interrogation_Position=367; Antisense; ATTTGCGGCAGACACTTTCGCCGGA
>probe:Drosophila_2:1631450_at:290:719; Interrogation_Position=383; Antisense; TTCGCCGGACTTATCTGCCAAACAA
>probe:Drosophila_2:1631450_at:584:393; Interrogation_Position=419; Antisense; GAAAGGACGCCATTCCAGAGTTCCA
>probe:Drosophila_2:1631450_at:327:549; Interrogation_Position=459; Antisense; GGAGGATCCCCTCGGAAAGAGCATC
>probe:Drosophila_2:1631450_at:62:657; Interrogation_Position=582; Antisense; TAATCCATGCGCCAATTGCCTTGAT
>probe:Drosophila_2:1631450_at:380:645; Interrogation_Position=630; Antisense; TCATCTTCGCATTCAGCAACTTGAG

Paste this into a BLAST search page for me
AGACCAAGGTGTTTTCCTGGGCAGTGCAGTTCCCACACTTTTCTTGAATAAGTGCACCAGGTCAGTAAGCCAAGCAGGAACTCCTTCATTCGCAGATGCAAGATGCAGCGTCAGGAACTGCTCCTTCGAATCCCGAAATGCGCAAGGCATATATGTCGGCTTACGGTGGACAACAAACAAGTGGCTGTTTATTTGCGGCAATTTGCGGCAGACACTTTCGCCGGATTCGCCGGACTTATCTGCCAAACAAGAAAGGACGCCATTCCAGAGTTCCAGGAGGATCCCCTCGGAAAGAGCATCTAATCCATGCGCCAATTGCCTTGATTCATCTTCGCATTCAGCAACTTGAG

Full Affymetrix probeset data:

Annotations for 1631450_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720