FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631451_at:

>probe:Drosophila_2:1631451_at:460:701; Interrogation_Position=1649; Antisense; TTTTGCAGGACCCATTCCGGAGAAA
>probe:Drosophila_2:1631451_at:494:519; Interrogation_Position=1683; Antisense; GTGGATCCTGTCACCATGATAGAAG
>probe:Drosophila_2:1631451_at:718:171; Interrogation_Position=1800; Antisense; AAAGAGCGCAGGTCAAGGCGTCCAC
>probe:Drosophila_2:1631451_at:48:573; Interrogation_Position=1816; Antisense; GGCGTCCACGGACAACAATCAGTGA
>probe:Drosophila_2:1631451_at:24:3; Interrogation_Position=1885; Antisense; ATAGAAGTGTGGCTGCCTTTCTGAA
>probe:Drosophila_2:1631451_at:631:297; Interrogation_Position=1899; Antisense; GCCTTTCTGAAAGCCGAGACCGAGT
>probe:Drosophila_2:1631451_at:205:411; Interrogation_Position=1916; Antisense; GACCGAGTATCGTACCAGTTTCGAA
>probe:Drosophila_2:1631451_at:37:215; Interrogation_Position=1940; Antisense; AAGAGATTCCGCCTTTGATGCGCAT
>probe:Drosophila_2:1631451_at:505:447; Interrogation_Position=1956; Antisense; GATGCGCATATCAATCGCTTTGAAA
>probe:Drosophila_2:1631451_at:722:707; Interrogation_Position=2002; Antisense; TTAAAGTCCATTCCTATTCAGCCAC
>probe:Drosophila_2:1631451_at:690:159; Interrogation_Position=2028; Antisense; ACAACGCCCACTCATCGGTAAATTT
>probe:Drosophila_2:1631451_at:258:619; Interrogation_Position=2076; Antisense; TGCATTTATGCGTCTCACTGGACTT
>probe:Drosophila_2:1631451_at:435:141; Interrogation_Position=2092; Antisense; ACTGGACTTCATTTTGCTCGGGACA
>probe:Drosophila_2:1631451_at:392:507; Interrogation_Position=2137; Antisense; GTGCGTTTCGTATCAACAGAGCCAA

Paste this into a BLAST search page for me
TTTTGCAGGACCCATTCCGGAGAAAGTGGATCCTGTCACCATGATAGAAGAAAGAGCGCAGGTCAAGGCGTCCACGGCGTCCACGGACAACAATCAGTGAATAGAAGTGTGGCTGCCTTTCTGAAGCCTTTCTGAAAGCCGAGACCGAGTGACCGAGTATCGTACCAGTTTCGAAAAGAGATTCCGCCTTTGATGCGCATGATGCGCATATCAATCGCTTTGAAATTAAAGTCCATTCCTATTCAGCCACACAACGCCCACTCATCGGTAAATTTTGCATTTATGCGTCTCACTGGACTTACTGGACTTCATTTTGCTCGGGACAGTGCGTTTCGTATCAACAGAGCCAA

Full Affymetrix probeset data:

Annotations for 1631451_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720