FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631455_at:

>probe:Drosophila_2:1631455_at:578:243; Interrogation_Position=1007; Antisense; AATATTCTCGGTCTGGGCTACAATC
>probe:Drosophila_2:1631455_at:77:221; Interrogation_Position=1045; Antisense; AAGTGAAACCATGTCGGGATCCGAT
>probe:Drosophila_2:1631455_at:547:529; Interrogation_Position=1060; Antisense; GGGATCCGATGCCTTGAGTGCCACA
>probe:Drosophila_2:1631455_at:584:505; Interrogation_Position=1077; Antisense; GTGCCACACGCAGTCCAAAGATTAA
>probe:Drosophila_2:1631455_at:232:107; Interrogation_Position=1113; Antisense; AGAACGGTTCTGCTAGCCCTTAAAG
>probe:Drosophila_2:1631455_at:698:217; Interrogation_Position=1185; Antisense; AAGTACATCCTATTCAACACCCAAT
>probe:Drosophila_2:1631455_at:486:11; Interrogation_Position=1270; Antisense; ATTCTCGATTTTTCTTACTTTGCTG
>probe:Drosophila_2:1631455_at:656:277; Interrogation_Position=1287; Antisense; CTTTGCTGATATTCGTAGCCCAATA
>probe:Drosophila_2:1631455_at:704:513; Interrogation_Position=1373; Antisense; GTGTTTCCTATTAACGTTGCCAATT
>probe:Drosophila_2:1631455_at:429:357; Interrogation_Position=1402; Antisense; GAATAGTTGGCTCTGTCCAATCGCT
>probe:Drosophila_2:1631455_at:172:147; Interrogation_Position=1428; Antisense; ACTAATCAAGCGCATGACCTTCGTG
>probe:Drosophila_2:1631455_at:445:639; Interrogation_Position=1448; Antisense; TCGTGCCCTCAAACTTGCAGTTGAA
>probe:Drosophila_2:1631455_at:183:617; Interrogation_Position=1488; Antisense; TGCATAGATACAGCTCACGGAAATT
>probe:Drosophila_2:1631455_at:311:35; Interrogation_Position=995; Antisense; ATCACGGCGCGTAATATTCTCGGTC

Paste this into a BLAST search page for me
AATATTCTCGGTCTGGGCTACAATCAAGTGAAACCATGTCGGGATCCGATGGGATCCGATGCCTTGAGTGCCACAGTGCCACACGCAGTCCAAAGATTAAAGAACGGTTCTGCTAGCCCTTAAAGAAGTACATCCTATTCAACACCCAATATTCTCGATTTTTCTTACTTTGCTGCTTTGCTGATATTCGTAGCCCAATAGTGTTTCCTATTAACGTTGCCAATTGAATAGTTGGCTCTGTCCAATCGCTACTAATCAAGCGCATGACCTTCGTGTCGTGCCCTCAAACTTGCAGTTGAATGCATAGATACAGCTCACGGAAATTATCACGGCGCGTAATATTCTCGGTC

Full Affymetrix probeset data:

Annotations for 1631455_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720