Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631456_at:

>probe:Drosophila_2:1631456_at:557:219; Interrogation_Position=1488; Antisense; AAGTGCCCAAGCGTGTCTACTTCAA
>probe:Drosophila_2:1631456_at:161:513; Interrogation_Position=1500; Antisense; GTGTCTACTTCAACAAGGGTCTGTA
>probe:Drosophila_2:1631456_at:626:81; Interrogation_Position=1515; Antisense; AGGGTCTGTAAGATCGGCTCGACAA
>probe:Drosophila_2:1631456_at:723:245; Interrogation_Position=1563; Antisense; AATTGTGTGTTAGTGGTATCCGTTC
>probe:Drosophila_2:1631456_at:380:47; Interrogation_Position=1580; Antisense; ATCCGTTCTCGTCTCATGTTTTATG
>probe:Drosophila_2:1631456_at:243:349; Interrogation_Position=1636; Antisense; GCAGTTGCAGTTGTTCCGTGTGTCA
>probe:Drosophila_2:1631456_at:250:471; Interrogation_Position=1648; Antisense; GTTCCGTGTGTCATGTGTCAATTGT
>probe:Drosophila_2:1631456_at:687:493; Interrogation_Position=1664; Antisense; GTCAATTGTCGTAGTTGCTAAGCTA
>probe:Drosophila_2:1631456_at:677:183; Interrogation_Position=1709; Antisense; AAAATGTAAATCTCGGACCTGCTAG
>probe:Drosophila_2:1631456_at:528:553; Interrogation_Position=1723; Antisense; GGACCTGCTAGGTTTTTCTAATTTG
>probe:Drosophila_2:1631456_at:625:703; Interrogation_Position=1819; Antisense; TTAGCAGGGCTAGCACATAATGGGT
>probe:Drosophila_2:1631456_at:449:485; Interrogation_Position=1860; Antisense; GTATGTCCTAAATCGTGTTCATGTT
>probe:Drosophila_2:1631456_at:702:145; Interrogation_Position=1940; Antisense; ACTAACTAAACTGAGCTGCTGAGCA
>probe:Drosophila_2:1631456_at:57:153; Interrogation_Position=2001; Antisense; CCAAACTCGTTGTGTTTCGTATTAG

Paste this into a BLAST search page for me
AAGTGCCCAAGCGTGTCTACTTCAAGTGTCTACTTCAACAAGGGTCTGTAAGGGTCTGTAAGATCGGCTCGACAAAATTGTGTGTTAGTGGTATCCGTTCATCCGTTCTCGTCTCATGTTTTATGGCAGTTGCAGTTGTTCCGTGTGTCAGTTCCGTGTGTCATGTGTCAATTGTGTCAATTGTCGTAGTTGCTAAGCTAAAAATGTAAATCTCGGACCTGCTAGGGACCTGCTAGGTTTTTCTAATTTGTTAGCAGGGCTAGCACATAATGGGTGTATGTCCTAAATCGTGTTCATGTTACTAACTAAACTGAGCTGCTGAGCACCAAACTCGTTGTGTTTCGTATTAG

Full Affymetrix probeset data:

Annotations for 1631456_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime