FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631457_at:

>probe:Drosophila_2:1631457_at:636:1; Interrogation_Position=122; Antisense; AGTGGGACGAACTGGACCGCTGGGA
>probe:Drosophila_2:1631457_at:325:129; Interrogation_Position=137; Antisense; ACCGCTGGGAGGAAACGCGCATTAT
>probe:Drosophila_2:1631457_at:80:177; Interrogation_Position=149; Antisense; AAACGCGCATTATGCGGAAGCTGCA
>probe:Drosophila_2:1631457_at:610:335; Interrogation_Position=168; Antisense; GCTGCAGATGAAGGTAGGCGACTGA
>probe:Drosophila_2:1631457_at:225:125; Interrogation_Position=42; Antisense; AGCCGGTACAGGATTGGCCCTGATC
>probe:Drosophila_2:1631457_at:360:73; Interrogation_Position=51; Antisense; AGGATTGGCCCTGATCCTGGCCGTG
>probe:Drosophila_2:1631457_at:713:603; Interrogation_Position=62; Antisense; TGATCCTGGCCGTGACAATCGTCAT
>probe:Drosophila_2:1631457_at:560:47; Interrogation_Position=64; Antisense; ATCCTGGCCGTGACAATCGTCATGT
>probe:Drosophila_2:1631457_at:294:581; Interrogation_Position=68; Antisense; TGGCCGTGACAATCGTCATGTACCG
>probe:Drosophila_2:1631457_at:319:511; Interrogation_Position=73; Antisense; GTGACAATCGTCATGTACCGCTACT
>probe:Drosophila_2:1631457_at:231:611; Interrogation_Position=74; Antisense; TGACAATCGTCATGTACCGCTACTA
>probe:Drosophila_2:1631457_at:564:495; Interrogation_Position=82; Antisense; GTCATGTACCGCTACTACCTTCTGC
>probe:Drosophila_2:1631457_at:387:147; Interrogation_Position=95; Antisense; ACTACCTTCTGCGTAAGCGTGGCAA
>probe:Drosophila_2:1631457_at:510:129; Interrogation_Position=98; Antisense; ACCTTCTGCGTAAGCGTGGCAAGGA

Paste this into a BLAST search page for me
AGTGGGACGAACTGGACCGCTGGGAACCGCTGGGAGGAAACGCGCATTATAAACGCGCATTATGCGGAAGCTGCAGCTGCAGATGAAGGTAGGCGACTGAAGCCGGTACAGGATTGGCCCTGATCAGGATTGGCCCTGATCCTGGCCGTGTGATCCTGGCCGTGACAATCGTCATATCCTGGCCGTGACAATCGTCATGTTGGCCGTGACAATCGTCATGTACCGGTGACAATCGTCATGTACCGCTACTTGACAATCGTCATGTACCGCTACTAGTCATGTACCGCTACTACCTTCTGCACTACCTTCTGCGTAAGCGTGGCAAACCTTCTGCGTAAGCGTGGCAAGGA

Full Affymetrix probeset data:

Annotations for 1631457_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720