FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631458_at:

>probe:Drosophila_2:1631458_at:186:667; Interrogation_Position=222; Antisense; TACATTTTTGTGTCTTCCACGACGA
>probe:Drosophila_2:1631458_at:29:119; Interrogation_Position=252; Antisense; AGCTCAAGGTGCTCATGGGCCTGAT
>probe:Drosophila_2:1631458_at:88:393; Interrogation_Position=278; Antisense; GACAAGGAGCTTTCCGAACCGTACT
>probe:Drosophila_2:1631458_at:383:17; Interrogation_Position=305; Antisense; ATTTACACCTATCGCTACTTTGTCT
>probe:Drosophila_2:1631458_at:70:249; Interrogation_Position=332; Antisense; AATTGGCCAGATCTATGCTTCTTCG
>probe:Drosophila_2:1631458_at:312:643; Interrogation_Position=351; Antisense; TCTTCGCCCTAGATGGAGATCGCTA
>probe:Drosophila_2:1631458_at:337:693; Interrogation_Position=421; Antisense; TTTGCAGGGCTATATCGCCATGCTG
>probe:Drosophila_2:1631458_at:358:523; Interrogation_Position=483; Antisense; GGGCTCTCTCGGAAATGGCCATAGA
>probe:Drosophila_2:1631458_at:133:411; Interrogation_Position=524; Antisense; GACGCAGCCATGATTGTCCTGGAAA
>probe:Drosophila_2:1631458_at:696:607; Interrogation_Position=555; Antisense; TGAGCAACAAACCTGCATTGGCGCT
>probe:Drosophila_2:1631458_at:173:383; Interrogation_Position=605; Antisense; GAACGTCGTTTTTTGCGCTACTACT
>probe:Drosophila_2:1631458_at:24:567; Interrogation_Position=635; Antisense; GGCATGGATGCCTTTCATTTGAAGC
>probe:Drosophila_2:1631458_at:275:139; Interrogation_Position=669; Antisense; ACGATTTCATCGACTCGTCCTTGAA
>probe:Drosophila_2:1631458_at:479:217; Interrogation_Position=705; Antisense; AAGTTTCCAGTGCTTCTGATCGGTT

Paste this into a BLAST search page for me
TACATTTTTGTGTCTTCCACGACGAAGCTCAAGGTGCTCATGGGCCTGATGACAAGGAGCTTTCCGAACCGTACTATTTACACCTATCGCTACTTTGTCTAATTGGCCAGATCTATGCTTCTTCGTCTTCGCCCTAGATGGAGATCGCTATTTGCAGGGCTATATCGCCATGCTGGGGCTCTCTCGGAAATGGCCATAGAGACGCAGCCATGATTGTCCTGGAAATGAGCAACAAACCTGCATTGGCGCTGAACGTCGTTTTTTGCGCTACTACTGGCATGGATGCCTTTCATTTGAAGCACGATTTCATCGACTCGTCCTTGAAAAGTTTCCAGTGCTTCTGATCGGTT

Full Affymetrix probeset data:

Annotations for 1631458_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720