FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631461_at:

>probe:Drosophila_2:1631461_at:652:277; Interrogation_Position=123; Antisense; CTATCCCTCCGTGAATCGTAATCTA
>probe:Drosophila_2:1631461_at:93:493; Interrogation_Position=140; Antisense; GTAATCTAACGCTTCAATTGGGCTA
>probe:Drosophila_2:1631461_at:513:91; Interrogation_Position=225; Antisense; AGTTTGGTACTCACGACACTTGCAA
>probe:Drosophila_2:1631461_at:414:199; Interrogation_Position=366; Antisense; AACCCTGCCGCGGAATATATTCCTG
>probe:Drosophila_2:1631461_at:530:21; Interrogation_Position=382; Antisense; ATATTCCTGTTATTTGCTTTGCCCT
>probe:Drosophila_2:1631461_at:698:693; Interrogation_Position=394; Antisense; TTTGCTTTGCCCTGGATATTGACCT
>probe:Drosophila_2:1631461_at:433:459; Interrogation_Position=408; Antisense; GATATTGACCTTTGTGGCCAGCGGA
>probe:Drosophila_2:1631461_at:296:523; Interrogation_Position=421; Antisense; GTGGCCAGCGGATTGATCAACTATA
>probe:Drosophila_2:1631461_at:727:549; Interrogation_Position=508; Antisense; GGAGAACTGCAAGGCCTCTTTTGGC
>probe:Drosophila_2:1631461_at:93:271; Interrogation_Position=532; Antisense; CATCGTTCTACATCCGTGACTTTAA
>probe:Drosophila_2:1631461_at:605:401; Interrogation_Position=549; Antisense; GACTTTAATACCCTATTGGTCGCAA
>probe:Drosophila_2:1631461_at:389:371; Interrogation_Position=600; Antisense; GAAGGCATCTCATCTTTCTGGAAAT
>probe:Drosophila_2:1631461_at:619:281; Interrogation_Position=64; Antisense; CTGCACTTGGGCTCAAATCTTCAGC
>probe:Drosophila_2:1631461_at:329:239; Interrogation_Position=79; Antisense; AATCTTCAGCCGGTCATCGAGGCGA

Paste this into a BLAST search page for me
CTATCCCTCCGTGAATCGTAATCTAGTAATCTAACGCTTCAATTGGGCTAAGTTTGGTACTCACGACACTTGCAAAACCCTGCCGCGGAATATATTCCTGATATTCCTGTTATTTGCTTTGCCCTTTTGCTTTGCCCTGGATATTGACCTGATATTGACCTTTGTGGCCAGCGGAGTGGCCAGCGGATTGATCAACTATAGGAGAACTGCAAGGCCTCTTTTGGCCATCGTTCTACATCCGTGACTTTAAGACTTTAATACCCTATTGGTCGCAAGAAGGCATCTCATCTTTCTGGAAATCTGCACTTGGGCTCAAATCTTCAGCAATCTTCAGCCGGTCATCGAGGCGA

Full Affymetrix probeset data:

Annotations for 1631461_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720