FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631464_at:

>probe:Drosophila_2:1631464_at:412:605; Interrogation_Position=415; Antisense; TGATATCCCTGCTCATCAGCGTGAC
>probe:Drosophila_2:1631464_at:406:115; Interrogation_Position=453; Antisense; AGCAGTTCCGTCGACATGGAGGCCA
>probe:Drosophila_2:1631464_at:192:67; Interrogation_Position=468; Antisense; ATGGAGGCCATACTGCGCCAGACAT
>probe:Drosophila_2:1631464_at:723:299; Interrogation_Position=495; Antisense; CCCGAACTCGGCGACGATGTGATAG
>probe:Drosophila_2:1631464_at:509:199; Interrogation_Position=547; Antisense; AACGAAACTTTGTGGAGGGCTCAAT
>probe:Drosophila_2:1631464_at:50:435; Interrogation_Position=561; Antisense; GAGGGCTCAATCAAGTCGGCCAACA
>probe:Drosophila_2:1631464_at:158:191; Interrogation_Position=582; Antisense; AACATACGTGCCTATCGGCTGGTCA
>probe:Drosophila_2:1631464_at:412:591; Interrogation_Position=601; Antisense; TGGTCAACCTGGACTGGCGACTGGA
>probe:Drosophila_2:1631464_at:455:299; Interrogation_Position=640; Antisense; CGCGGAGCCTGCTGGATCAGTGTCA
>probe:Drosophila_2:1631464_at:557:377; Interrogation_Position=680; Antisense; GAAGCTATATCTGCACACCGAACCG
>probe:Drosophila_2:1631464_at:29:135; Interrogation_Position=781; Antisense; ACGAGCGGCTGCATCGAAAGGATTT
>probe:Drosophila_2:1631464_at:406:141; Interrogation_Position=816; Antisense; ACGGATGTCTGCAGTCTGGTGCACA
>probe:Drosophila_2:1631464_at:362:103; Interrogation_Position=877; Antisense; AGACGCGGCGCATTCGCAATATTGT
>probe:Drosophila_2:1631464_at:230:137; Interrogation_Position=919; Antisense; ACGACTCCAGAACTCATACACTTGT

Paste this into a BLAST search page for me
TGATATCCCTGCTCATCAGCGTGACAGCAGTTCCGTCGACATGGAGGCCAATGGAGGCCATACTGCGCCAGACATCCCGAACTCGGCGACGATGTGATAGAACGAAACTTTGTGGAGGGCTCAATGAGGGCTCAATCAAGTCGGCCAACAAACATACGTGCCTATCGGCTGGTCATGGTCAACCTGGACTGGCGACTGGACGCGGAGCCTGCTGGATCAGTGTCAGAAGCTATATCTGCACACCGAACCGACGAGCGGCTGCATCGAAAGGATTTACGGATGTCTGCAGTCTGGTGCACAAGACGCGGCGCATTCGCAATATTGTACGACTCCAGAACTCATACACTTGT

Full Affymetrix probeset data:

Annotations for 1631464_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720