FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631465_at:

>probe:Drosophila_2:1631465_at:406:601; Interrogation_Position=1015; Antisense; TGTACGACCTGCTTGGCGAGATATT
>probe:Drosophila_2:1631465_at:16:429; Interrogation_Position=1032; Antisense; GAGATATTCCATTCCGAGCAGTCAG
>probe:Drosophila_2:1631465_at:232:227; Interrogation_Position=1101; Antisense; AATGGAACGCTATCCACTACCTCGA
>probe:Drosophila_2:1631465_at:478:575; Interrogation_Position=1136; Antisense; GGCGAATCCACTACAGCACATGGGA
>probe:Drosophila_2:1631465_at:262:65; Interrogation_Position=1155; Antisense; ATGGGACTTATGCTGCAGCTGCCAA
>probe:Drosophila_2:1631465_at:722:173; Interrogation_Position=1178; Antisense; AAAGCTGGTGTCCAAGGCATCCAAA
>probe:Drosophila_2:1631465_at:350:459; Interrogation_Position=1203; Antisense; GATTTGTAGCTTGCGAACTGCTCAT
>probe:Drosophila_2:1631465_at:396:139; Interrogation_Position=840; Antisense; ACGGTCCCGGCAGAAATGCGCACAG
>probe:Drosophila_2:1631465_at:510:75; Interrogation_Position=883; Antisense; AGGAGGCCAAGACATCAACCCGCTG
>probe:Drosophila_2:1631465_at:542:201; Interrogation_Position=899; Antisense; AACCCGCTGTATTGAAGCATTGCCA
>probe:Drosophila_2:1631465_at:472:543; Interrogation_Position=929; Antisense; GGATTTCGATGACGCATTCCTGCAG
>probe:Drosophila_2:1631465_at:607:405; Interrogation_Position=955; Antisense; GACTGCGTCCCGAAATCAAGCACAT
>probe:Drosophila_2:1631465_at:202:613; Interrogation_Position=979; Antisense; TGAACTTCCACCAGAAGCTGTACTT
>probe:Drosophila_2:1631465_at:174:119; Interrogation_Position=994; Antisense; AGCTGTACTTCAAGCGACGTGTGTA

Paste this into a BLAST search page for me
TGTACGACCTGCTTGGCGAGATATTGAGATATTCCATTCCGAGCAGTCAGAATGGAACGCTATCCACTACCTCGAGGCGAATCCACTACAGCACATGGGAATGGGACTTATGCTGCAGCTGCCAAAAAGCTGGTGTCCAAGGCATCCAAAGATTTGTAGCTTGCGAACTGCTCATACGGTCCCGGCAGAAATGCGCACAGAGGAGGCCAAGACATCAACCCGCTGAACCCGCTGTATTGAAGCATTGCCAGGATTTCGATGACGCATTCCTGCAGGACTGCGTCCCGAAATCAAGCACATTGAACTTCCACCAGAAGCTGTACTTAGCTGTACTTCAAGCGACGTGTGTA

Full Affymetrix probeset data:

Annotations for 1631465_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720