Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631466_at:

>probe:Drosophila_2:1631466_at:171:329; Interrogation_Position=1592; Antisense; GCGTCTGCGATCATTCAATAGTCCT
>probe:Drosophila_2:1631466_at:443:239; Interrogation_Position=1608; Antisense; AATAGTCCTGTGACAACGCCAACGT
>probe:Drosophila_2:1631466_at:224:211; Interrogation_Position=1668; Antisense; AAGAAACTGCTTTACTATGCCGCCG
>probe:Drosophila_2:1631466_at:284:157; Interrogation_Position=1704; Antisense; AAACCGGGCTTCATCAAGGAACCTG
>probe:Drosophila_2:1631466_at:47:227; Interrogation_Position=1719; Antisense; AAGGAACCTGGATTCTCCGCGGACG
>probe:Drosophila_2:1631466_at:670:511; Interrogation_Position=1795; Antisense; GTGAGGACTGCTGCGACTATCCGAA
>probe:Drosophila_2:1631466_at:725:147; Interrogation_Position=1810; Antisense; ACTATCCGAAATGTCAGGCGTTTGA
>probe:Drosophila_2:1631466_at:334:73; Interrogation_Position=1891; Antisense; AGGACGTCGTTCTGTGCGCCAAGTT
>probe:Drosophila_2:1631466_at:250:507; Interrogation_Position=1904; Antisense; GTGCGCCAAGTTTAGCCCCAGGGAA
>probe:Drosophila_2:1631466_at:627:201; Interrogation_Position=1927; Antisense; AACCGCTCCTTGTAACCGGATGCAA
>probe:Drosophila_2:1631466_at:536:297; Interrogation_Position=1957; Antisense; GCGAGGTGACCTGGTATCGACCCAA
>probe:Drosophila_2:1631466_at:509:485; Interrogation_Position=1985; Antisense; GTAGACTTCAGTTGAGCCGGGCGAA
>probe:Drosophila_2:1631466_at:673:299; Interrogation_Position=2013; Antisense; CGCGCTCACTGTCAATCTGTATATT
>probe:Drosophila_2:1631466_at:292:359; Interrogation_Position=2095; Antisense; GCAACGCGATTATGGTGGACCGATA

Paste this into a BLAST search page for me
GCGTCTGCGATCATTCAATAGTCCTAATAGTCCTGTGACAACGCCAACGTAAGAAACTGCTTTACTATGCCGCCGAAACCGGGCTTCATCAAGGAACCTGAAGGAACCTGGATTCTCCGCGGACGGTGAGGACTGCTGCGACTATCCGAAACTATCCGAAATGTCAGGCGTTTGAAGGACGTCGTTCTGTGCGCCAAGTTGTGCGCCAAGTTTAGCCCCAGGGAAAACCGCTCCTTGTAACCGGATGCAAGCGAGGTGACCTGGTATCGACCCAAGTAGACTTCAGTTGAGCCGGGCGAACGCGCTCACTGTCAATCTGTATATTGCAACGCGATTATGGTGGACCGATA

Full Affymetrix probeset data:

Annotations for 1631466_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime