FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631467_at:

>probe:Drosophila_2:1631467_at:307:343; Interrogation_Position=1028; Antisense; GCTTCTACCTCGACTTTAGCCGAAA
>probe:Drosophila_2:1631467_at:82:419; Interrogation_Position=1061; Antisense; GAGCTGATCAATTCGCGACGCCAAG
>probe:Drosophila_2:1631467_at:653:601; Interrogation_Position=1120; Antisense; TGTATCCTCTGGGTTAGCATTGAAT
>probe:Drosophila_2:1631467_at:724:369; Interrogation_Position=1141; Antisense; GAATGGCGCTAATTCCACAACTTTG
>probe:Drosophila_2:1631467_at:454:239; Interrogation_Position=1175; Antisense; AATAACAGTTTGTCGGCGGCTTTGT
>probe:Drosophila_2:1631467_at:14:331; Interrogation_Position=1190; Antisense; GCGGCTTTGTTACTCATCCAAGATA
>probe:Drosophila_2:1631467_at:538:93; Interrogation_Position=1210; Antisense; AGATATGAACGCATCCCAACTGGAG
>probe:Drosophila_2:1631467_at:709:509; Interrogation_Position=806; Antisense; GTGAATGGTGAACGCTTGCCTCTGT
>probe:Drosophila_2:1631467_at:221:329; Interrogation_Position=847; Antisense; GCGTCAGGTGCGTCAGGCTCAAAAA
>probe:Drosophila_2:1631467_at:462:173; Interrogation_Position=869; Antisense; AAAGCTCAGGATGCGCTTCGGAAGC
>probe:Drosophila_2:1631467_at:303:471; Interrogation_Position=926; Antisense; GTTCAGCAGGCTCATAAGTTTACGA
>probe:Drosophila_2:1631467_at:131:217; Interrogation_Position=941; Antisense; AAGTTTACGATGACTCCGCAGGCTG
>probe:Drosophila_2:1631467_at:246:189; Interrogation_Position=972; Antisense; AACAGGTTCAGGGTATTCAGTCAAT
>probe:Drosophila_2:1631467_at:301:13; Interrogation_Position=986; Antisense; ATTCAGTCAATTTCATCGGATCGGA

Paste this into a BLAST search page for me
GCTTCTACCTCGACTTTAGCCGAAAGAGCTGATCAATTCGCGACGCCAAGTGTATCCTCTGGGTTAGCATTGAATGAATGGCGCTAATTCCACAACTTTGAATAACAGTTTGTCGGCGGCTTTGTGCGGCTTTGTTACTCATCCAAGATAAGATATGAACGCATCCCAACTGGAGGTGAATGGTGAACGCTTGCCTCTGTGCGTCAGGTGCGTCAGGCTCAAAAAAAAGCTCAGGATGCGCTTCGGAAGCGTTCAGCAGGCTCATAAGTTTACGAAAGTTTACGATGACTCCGCAGGCTGAACAGGTTCAGGGTATTCAGTCAATATTCAGTCAATTTCATCGGATCGGA

Full Affymetrix probeset data:

Annotations for 1631467_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720