FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631469_at:

>probe:Drosophila_2:1631469_at:5:273; Interrogation_Position=1037; Antisense; CTAGGTCTGGGCGTAGGCTTCAAGA
>probe:Drosophila_2:1631469_at:377:553; Interrogation_Position=541; Antisense; GGAGCCGTGAAGCATAGCAGCCACA
>probe:Drosophila_2:1631469_at:109:441; Interrogation_Position=578; Antisense; GAGGCCAGCAGATTCAGCCGCCAAA
>probe:Drosophila_2:1631469_at:659:121; Interrogation_Position=593; Antisense; AGCCGCCAAACCAGTACCAACAGTA
>probe:Drosophila_2:1631469_at:455:189; Interrogation_Position=611; Antisense; AACAGTATAAACAGCCCGAGGCGGA
>probe:Drosophila_2:1631469_at:423:217; Interrogation_Position=638; Antisense; AAGTGCGTCCGGCTAGCCAAGTGAT
>probe:Drosophila_2:1631469_at:322:605; Interrogation_Position=659; Antisense; TGATGGGTCAGGTGCACGACGCCTT
>probe:Drosophila_2:1631469_at:283:411; Interrogation_Position=676; Antisense; GACGCCTTCTACAGGGTGCTGCGAG
>probe:Drosophila_2:1631469_at:60:305; Interrogation_Position=713; Antisense; CCGTTTTGGGCAATGCGGCGGTCAA
>probe:Drosophila_2:1631469_at:517:647; Interrogation_Position=768; Antisense; TCAGGCAGCCGCAGTGGAAGTCTCG
>probe:Drosophila_2:1631469_at:672:53; Interrogation_Position=812; Antisense; ATGAACGTGACGACGGCCAGGACGA
>probe:Drosophila_2:1631469_at:642:443; Interrogation_Position=835; Antisense; GATGAGACGCCGTTAAAGCGCCGCA
>probe:Drosophila_2:1631469_at:22:355; Interrogation_Position=887; Antisense; GCAGCCAAGAGAACGCCTCGGGACA
>probe:Drosophila_2:1631469_at:505:89; Interrogation_Position=971; Antisense; AGTACAGCGCGTTCAGCGATGGCTT

Paste this into a BLAST search page for me
CTAGGTCTGGGCGTAGGCTTCAAGAGGAGCCGTGAAGCATAGCAGCCACAGAGGCCAGCAGATTCAGCCGCCAAAAGCCGCCAAACCAGTACCAACAGTAAACAGTATAAACAGCCCGAGGCGGAAAGTGCGTCCGGCTAGCCAAGTGATTGATGGGTCAGGTGCACGACGCCTTGACGCCTTCTACAGGGTGCTGCGAGCCGTTTTGGGCAATGCGGCGGTCAATCAGGCAGCCGCAGTGGAAGTCTCGATGAACGTGACGACGGCCAGGACGAGATGAGACGCCGTTAAAGCGCCGCAGCAGCCAAGAGAACGCCTCGGGACAAGTACAGCGCGTTCAGCGATGGCTT

Full Affymetrix probeset data:

Annotations for 1631469_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720