FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631470_at:

>probe:Drosophila_2:1631470_at:498:285; Interrogation_Position=1008; Antisense; CTGTATTATGTATCGCCTGGTTCGC
>probe:Drosophila_2:1631470_at:218:279; Interrogation_Position=1037; Antisense; CTACGCACTTTGATGGAGGGCACCA
>probe:Drosophila_2:1631470_at:699:525; Interrogation_Position=1054; Antisense; GGGCACCACGTGAAGAACCTTGACA
>probe:Drosophila_2:1631470_at:522:215; Interrogation_Position=1135; Antisense; AAGTTTCACCCTTCGAATTCATTCT
>probe:Drosophila_2:1631470_at:574:391; Interrogation_Position=1178; Antisense; GAAACGACAATGACACTACCCTCTT
>probe:Drosophila_2:1631470_at:262:147; Interrogation_Position=1206; Antisense; ACTCACGTCGTTTCTTAGTGTTCTA
>probe:Drosophila_2:1631470_at:229:677; Interrogation_Position=1284; Antisense; TAGTGACTCGTTATCCCAGTTCAGA
>probe:Drosophila_2:1631470_at:497:217; Interrogation_Position=1366; Antisense; AAGTCTAGGCCCGTTGTCAAGAACT
>probe:Drosophila_2:1631470_at:541:555; Interrogation_Position=1391; Antisense; GGACCCGTGGCTTCATAAATCATTA
>probe:Drosophila_2:1631470_at:285:5; Interrogation_Position=1421; Antisense; ATTGTGCGTTTGATGTGTCCCTTAA
>probe:Drosophila_2:1631470_at:37:181; Interrogation_Position=1476; Antisense; AAAACTTTCCTAGCATTCTTCAATG
>probe:Drosophila_2:1631470_at:188:465; Interrogation_Position=939; Antisense; GATTGTTGTTTACACGGCGGAGCAA
>probe:Drosophila_2:1631470_at:163:357; Interrogation_Position=960; Antisense; GCAAGGAGTTACTGTGTTCCCGCTG
>probe:Drosophila_2:1631470_at:563:323; Interrogation_Position=991; Antisense; GCGCTTGATCCGAACGGCTGTATTA

Paste this into a BLAST search page for me
CTGTATTATGTATCGCCTGGTTCGCCTACGCACTTTGATGGAGGGCACCAGGGCACCACGTGAAGAACCTTGACAAAGTTTCACCCTTCGAATTCATTCTGAAACGACAATGACACTACCCTCTTACTCACGTCGTTTCTTAGTGTTCTATAGTGACTCGTTATCCCAGTTCAGAAAGTCTAGGCCCGTTGTCAAGAACTGGACCCGTGGCTTCATAAATCATTAATTGTGCGTTTGATGTGTCCCTTAAAAAACTTTCCTAGCATTCTTCAATGGATTGTTGTTTACACGGCGGAGCAAGCAAGGAGTTACTGTGTTCCCGCTGGCGCTTGATCCGAACGGCTGTATTA

Full Affymetrix probeset data:

Annotations for 1631470_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720