FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631472_at:

>probe:Drosophila_2:1631472_at:97:613; Interrogation_Position=1007; Antisense; TGACAATCCCGAAAGCATCCAGCTG
>probe:Drosophila_2:1631472_at:701:97; Interrogation_Position=1033; Antisense; AGATGCAGTTGGTCGAGTCCCGCAA
>probe:Drosophila_2:1631472_at:481:85; Interrogation_Position=1048; Antisense; AGTCCCGCAATCTGGGTGGTGCCAT
>probe:Drosophila_2:1631472_at:112:519; Interrogation_Position=1063; Antisense; GTGGTGCCATGATGTGGTCCATCGA
>probe:Drosophila_2:1631472_at:571:573; Interrogation_Position=1113; Antisense; GGCGAGTCCTATCCACTGCTGAAGA
>probe:Drosophila_2:1631472_at:346:103; Interrogation_Position=1135; Antisense; AGACCATGAATCGTGCTCTTGGCAG
>probe:Drosophila_2:1631472_at:727:421; Interrogation_Position=1201; Antisense; GAGAAGGAAGTGTTACTCCCGCTCC
>probe:Drosophila_2:1631472_at:324:593; Interrogation_Position=1280; Antisense; TGGTGGCAACGAGTGCGCCCAAGAT
>probe:Drosophila_2:1631472_at:487:29; Interrogation_Position=1333; Antisense; ATAAGTTCTACCAGTGCGTCGGTGG
>probe:Drosophila_2:1631472_at:313:473; Interrogation_Position=1363; Antisense; GTTACGACTTCCAATGCGGAGCAGG
>probe:Drosophila_2:1631472_at:126:83; Interrogation_Position=1385; Antisense; AGGGCTGTGCTTCAATACCATTACC
>probe:Drosophila_2:1631472_at:54:551; Interrogation_Position=896; Antisense; GGAGAACGGATTCCTGGGCTACCAC
>probe:Drosophila_2:1631472_at:56:161; Interrogation_Position=934; Antisense; ACAACTGGCAAACCGTGTTCGATCA
>probe:Drosophila_2:1631472_at:609:629; Interrogation_Position=971; Antisense; TCCATATGCCTTCCAGGGTGATCAG

Paste this into a BLAST search page for me
TGACAATCCCGAAAGCATCCAGCTGAGATGCAGTTGGTCGAGTCCCGCAAAGTCCCGCAATCTGGGTGGTGCCATGTGGTGCCATGATGTGGTCCATCGAGGCGAGTCCTATCCACTGCTGAAGAAGACCATGAATCGTGCTCTTGGCAGGAGAAGGAAGTGTTACTCCCGCTCCTGGTGGCAACGAGTGCGCCCAAGATATAAGTTCTACCAGTGCGTCGGTGGGTTACGACTTCCAATGCGGAGCAGGAGGGCTGTGCTTCAATACCATTACCGGAGAACGGATTCCTGGGCTACCACACAACTGGCAAACCGTGTTCGATCATCCATATGCCTTCCAGGGTGATCAG

Full Affymetrix probeset data:

Annotations for 1631472_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720