FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631473_at:

>probe:Drosophila_2:1631473_at:618:331; Interrogation_Position=457; Antisense; GCGGCATCCACCAACATGTTTTATT
>probe:Drosophila_2:1631473_at:360:689; Interrogation_Position=478; Antisense; TATTTTTGGCCGTTTTGCGTTCAGT
>probe:Drosophila_2:1631473_at:504:255; Interrogation_Position=499; Antisense; CAGTTTTTAATTGCGATTGCCCTTG
>probe:Drosophila_2:1631473_at:283:9; Interrogation_Position=514; Antisense; ATTGCCCTTGTTTCAGTTTCACTTA
>probe:Drosophila_2:1631473_at:226:523; Interrogation_Position=613; Antisense; GGGCCAGTCAGCTGTTTTCAGATTC
>probe:Drosophila_2:1631473_at:190:697; Interrogation_Position=628; Antisense; TTTCAGATTCCGAGCAGCTGCAGAC
>probe:Drosophila_2:1631473_at:195:205; Interrogation_Position=654; Antisense; AAGCGCCGAAGCAGCGTCGTTTGAC
>probe:Drosophila_2:1631473_at:124:499; Interrogation_Position=669; Antisense; GTCGTTTGACGTTTCTTTTTCACAT
>probe:Drosophila_2:1631473_at:4:701; Interrogation_Position=685; Antisense; TTTTCACATTCTCTCACTTTTGCTA
>probe:Drosophila_2:1631473_at:43:149; Interrogation_Position=700; Antisense; ACTTTTGCTAAGACTCTCACGCTGG
>probe:Drosophila_2:1631473_at:164:335; Interrogation_Position=727; Antisense; GCTGCGGGTGACAAAGGCTCCTTTA
>probe:Drosophila_2:1631473_at:508:5; Interrogation_Position=741; Antisense; AGGCTCCTTTAACTATTCCACTATG
>probe:Drosophila_2:1631473_at:17:323; Interrogation_Position=836; Antisense; GCGCCCCTGCACAGTGGTGAAATGT
>probe:Drosophila_2:1631473_at:154:239; Interrogation_Position=945; Antisense; AATACCTTCCCAATATCTAACTTCA

Paste this into a BLAST search page for me
GCGGCATCCACCAACATGTTTTATTTATTTTTGGCCGTTTTGCGTTCAGTCAGTTTTTAATTGCGATTGCCCTTGATTGCCCTTGTTTCAGTTTCACTTAGGGCCAGTCAGCTGTTTTCAGATTCTTTCAGATTCCGAGCAGCTGCAGACAAGCGCCGAAGCAGCGTCGTTTGACGTCGTTTGACGTTTCTTTTTCACATTTTTCACATTCTCTCACTTTTGCTAACTTTTGCTAAGACTCTCACGCTGGGCTGCGGGTGACAAAGGCTCCTTTAAGGCTCCTTTAACTATTCCACTATGGCGCCCCTGCACAGTGGTGAAATGTAATACCTTCCCAATATCTAACTTCA

Full Affymetrix probeset data:

Annotations for 1631473_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720