Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631475_at:

>probe:Drosophila_2:1631475_at:398:439; Interrogation_Position=192; Antisense; GGTCCGGTCACCAAGGGAGTTTATG
>probe:Drosophila_2:1631475_at:467:121; Interrogation_Position=218; Antisense; AGCGGTCAACGCCAATGGTCATGCA
>probe:Drosophila_2:1631475_at:197:241; Interrogation_Position=321; Antisense; AATAACGCCGCTCTGAATGCCACTG
>probe:Drosophila_2:1631475_at:259:619; Interrogation_Position=344; Antisense; TGCATTTCACAGTCATAGCCGATCG
>probe:Drosophila_2:1631475_at:238:259; Interrogation_Position=369; Antisense; CACGATCAGTTTGGCGGAGGACTCA
>probe:Drosophila_2:1631475_at:161:217; Interrogation_Position=392; Antisense; CAATTTGCAAACTGGAACGGGTCAC
>probe:Drosophila_2:1631475_at:141:147; Interrogation_Position=435; Antisense; ACTAGGGTTCCTCAGTTCGGCATGA
>probe:Drosophila_2:1631475_at:584:267; Interrogation_Position=468; Antisense; CAGGCTTCTGGCACAGCAAATCTGT
>probe:Drosophila_2:1631475_at:450:165; Interrogation_Position=485; Antisense; AAATCTGTATACCTCTCCAAGTGGC
>probe:Drosophila_2:1631475_at:561:249; Interrogation_Position=502; Antisense; CAAGTGGCAATCTCAACCTCAACGC
>probe:Drosophila_2:1631475_at:459:563; Interrogation_Position=531; Antisense; GGAAGTGCCAATCATCACCTCAGGG
>probe:Drosophila_2:1631475_at:289:47; Interrogation_Position=561; Antisense; ATGCGCGGCAAGTCCGATTTCGGCA
>probe:Drosophila_2:1631475_at:450:17; Interrogation_Position=577; Antisense; ATTTCGGCACCGGAGTTAACTTGCG
>probe:Drosophila_2:1631475_at:51:495; Interrogation_Position=646; Antisense; GTCACATTTAGTACTTGCACGTAGC

Paste this into a BLAST search page for me
GGTCCGGTCACCAAGGGAGTTTATGAGCGGTCAACGCCAATGGTCATGCAAATAACGCCGCTCTGAATGCCACTGTGCATTTCACAGTCATAGCCGATCGCACGATCAGTTTGGCGGAGGACTCACAATTTGCAAACTGGAACGGGTCACACTAGGGTTCCTCAGTTCGGCATGACAGGCTTCTGGCACAGCAAATCTGTAAATCTGTATACCTCTCCAAGTGGCCAAGTGGCAATCTCAACCTCAACGCGGAAGTGCCAATCATCACCTCAGGGATGCGCGGCAAGTCCGATTTCGGCAATTTCGGCACCGGAGTTAACTTGCGGTCACATTTAGTACTTGCACGTAGC

Full Affymetrix probeset data:

Annotations for 1631475_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime