FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631479_at:

>probe:Drosophila_2:1631479_at:260:551; Interrogation_Position=1048; Antisense; GGAGAGTCGCTAGTGTTAGTCCCCT
>probe:Drosophila_2:1631479_at:192:677; Interrogation_Position=1064; Antisense; TAGTCCCCTCGAAACCATGAGTGTA
>probe:Drosophila_2:1631479_at:710:677; Interrogation_Position=1121; Antisense; TATGGTTATCCCTCCTAGAATTAAG
>probe:Drosophila_2:1631479_at:365:189; Interrogation_Position=1147; Antisense; AACTTCCACTTCCTAACTCGTGTGA
>probe:Drosophila_2:1631479_at:65:277; Interrogation_Position=1187; Antisense; CTTCTTTGCTGCATTTGCTCATGAT
>probe:Drosophila_2:1631479_at:263:139; Interrogation_Position=1219; Antisense; ACGTTCTCCGTTTGCAATATTTTAT
>probe:Drosophila_2:1631479_at:176:109; Interrogation_Position=740; Antisense; AGAACCTGCAGAGGCGATTCATTCG
>probe:Drosophila_2:1631479_at:94:119; Interrogation_Position=769; Antisense; AGCTCGCAGGCGACGATAACGCATC
>probe:Drosophila_2:1631479_at:54:199; Interrogation_Position=786; Antisense; AACGCATCTCAAGAAGCTGGTGGCC
>probe:Drosophila_2:1631479_at:711:209; Interrogation_Position=811; Antisense; AAGAAGATCCTCAACGGCATCGAAA
>probe:Drosophila_2:1631479_at:313:101; Interrogation_Position=841; Antisense; AGAGAGATCGACATACTGTGCAACG
>probe:Drosophila_2:1631479_at:180:619; Interrogation_Position=872; Antisense; TGCTCGGCAAGGATCACACGCTGAA
>probe:Drosophila_2:1631479_at:64:615; Interrogation_Position=893; Antisense; TGAAGTTCGTCTACGTGACGCGCTG
>probe:Drosophila_2:1631479_at:721:499; Interrogation_Position=961; Antisense; GTCGAGCTCTAACCACTGTTTTAGT

Paste this into a BLAST search page for me
GGAGAGTCGCTAGTGTTAGTCCCCTTAGTCCCCTCGAAACCATGAGTGTATATGGTTATCCCTCCTAGAATTAAGAACTTCCACTTCCTAACTCGTGTGACTTCTTTGCTGCATTTGCTCATGATACGTTCTCCGTTTGCAATATTTTATAGAACCTGCAGAGGCGATTCATTCGAGCTCGCAGGCGACGATAACGCATCAACGCATCTCAAGAAGCTGGTGGCCAAGAAGATCCTCAACGGCATCGAAAAGAGAGATCGACATACTGTGCAACGTGCTCGGCAAGGATCACACGCTGAATGAAGTTCGTCTACGTGACGCGCTGGTCGAGCTCTAACCACTGTTTTAGT

Full Affymetrix probeset data:

Annotations for 1631479_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720