Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631480_at:

>probe:Drosophila_2:1631480_at:390:557; Interrogation_Position=405; Antisense; GGACAGCGCTCCGTTTGAGATTGGC
>probe:Drosophila_2:1631480_at:178:435; Interrogation_Position=430; Antisense; GAGGTACTGGGCAGCGACTTTCCCG
>probe:Drosophila_2:1631480_at:21:149; Interrogation_Position=446; Antisense; ACTTTCCCGTGGAGGTGCAGGTGCA
>probe:Drosophila_2:1631480_at:266:509; Interrogation_Position=466; Antisense; GTGCAGTATATGGATGCCCGCATGT
>probe:Drosophila_2:1631480_at:233:495; Interrogation_Position=533; Antisense; GTCACGCCGGTATTTGCGAGGAGAT
>probe:Drosophila_2:1631480_at:311:215; Interrogation_Position=565; Antisense; AAGATGATATTCGTCAATCCCTCGC
>probe:Drosophila_2:1631480_at:311:235; Interrogation_Position=580; Antisense; AATCCCTCGCCCATGATGAGACAGA
>probe:Drosophila_2:1631480_at:377:423; Interrogation_Position=597; Antisense; GAGACAGAATCTAACGCCCGTGCTT
>probe:Drosophila_2:1631480_at:151:401; Interrogation_Position=654; Antisense; GACATCGCCCCAGTTTGCAATGGAG
>probe:Drosophila_2:1631480_at:385:229; Interrogation_Position=672; Antisense; AATGGAGTCCGCCATGCCGGAGACA
>probe:Drosophila_2:1631480_at:47:567; Interrogation_Position=768; Antisense; GGCAAAGCAGCCCAAGAAGCGTCTA
>probe:Drosophila_2:1631480_at:199:207; Interrogation_Position=784; Antisense; AAGCGTCTAAGTGTGGGCATACCCC
>probe:Drosophila_2:1631480_at:549:45; Interrogation_Position=809; Antisense; ATCCCATCGGTCATCAGTAGTCGTG
>probe:Drosophila_2:1631480_at:420:227; Interrogation_Position=871; Antisense; AATGTTTGTTGTCCTGGCATGTGCA

Paste this into a BLAST search page for me
GGACAGCGCTCCGTTTGAGATTGGCGAGGTACTGGGCAGCGACTTTCCCGACTTTCCCGTGGAGGTGCAGGTGCAGTGCAGTATATGGATGCCCGCATGTGTCACGCCGGTATTTGCGAGGAGATAAGATGATATTCGTCAATCCCTCGCAATCCCTCGCCCATGATGAGACAGAGAGACAGAATCTAACGCCCGTGCTTGACATCGCCCCAGTTTGCAATGGAGAATGGAGTCCGCCATGCCGGAGACAGGCAAAGCAGCCCAAGAAGCGTCTAAAGCGTCTAAGTGTGGGCATACCCCATCCCATCGGTCATCAGTAGTCGTGAATGTTTGTTGTCCTGGCATGTGCA

Full Affymetrix probeset data:

Annotations for 1631480_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime