FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631483_at:

>probe:Drosophila_2:1631483_at:558:555; Interrogation_Position=1021; Antisense; GGACGGGTAATTCAGCGCAGCTACA
>probe:Drosophila_2:1631483_at:305:545; Interrogation_Position=1053; Antisense; GGATCACACCTATCTACGTTTGGAG
>probe:Drosophila_2:1631483_at:309:171; Interrogation_Position=1158; Antisense; AAAGCTTGAAACTGGATCTCGCGTC
>probe:Drosophila_2:1631483_at:400:3; Interrogation_Position=1184; Antisense; ATTGGAGTGCGCCACGTGGATCCTT
>probe:Drosophila_2:1631483_at:488:281; Interrogation_Position=1213; Antisense; CTCTCTGATCTCACTGCACATAGAA
>probe:Drosophila_2:1631483_at:212:395; Interrogation_Position=1235; Antisense; GAAATATTCTACTCCTAGCGGCGGG
>probe:Drosophila_2:1631483_at:108:291; Interrogation_Position=1263; Antisense; CGGATTAACGCCAATTCTGAGCCTA
>probe:Drosophila_2:1631483_at:263:609; Interrogation_Position=1280; Antisense; TGAGCCTAATTCAGCCCATCTTGAA
>probe:Drosophila_2:1631483_at:413:107; Interrogation_Position=1379; Antisense; AGAAACTCCATGAACTACACACCGA
>probe:Drosophila_2:1631483_at:308:357; Interrogation_Position=1421; Antisense; GCACAAATTATGTCTCCCAATCGGA
>probe:Drosophila_2:1631483_at:342:293; Interrogation_Position=1476; Antisense; GCTAGCCCCTTTGTTCCAGAAAAAT
>probe:Drosophila_2:1631483_at:8:491; Interrogation_Position=1514; Antisense; GTACTTATGTGCTCATTTGCGGACC
>probe:Drosophila_2:1631483_at:226:461; Interrogation_Position=1544; Antisense; GATTCAATACCGCTGCCTTAGATAT
>probe:Drosophila_2:1631483_at:66:239; Interrogation_Position=1594; Antisense; AATCAAATTCACGTATTCCGCGGCT

Paste this into a BLAST search page for me
GGACGGGTAATTCAGCGCAGCTACAGGATCACACCTATCTACGTTTGGAGAAAGCTTGAAACTGGATCTCGCGTCATTGGAGTGCGCCACGTGGATCCTTCTCTCTGATCTCACTGCACATAGAAGAAATATTCTACTCCTAGCGGCGGGCGGATTAACGCCAATTCTGAGCCTATGAGCCTAATTCAGCCCATCTTGAAAGAAACTCCATGAACTACACACCGAGCACAAATTATGTCTCCCAATCGGAGCTAGCCCCTTTGTTCCAGAAAAATGTACTTATGTGCTCATTTGCGGACCGATTCAATACCGCTGCCTTAGATATAATCAAATTCACGTATTCCGCGGCT

Full Affymetrix probeset data:

Annotations for 1631483_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720