FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631484_at:

>probe:Drosophila_2:1631484_at:518:309; Interrogation_Position=369; Antisense; CCAGAGCGCGGTTAGTGTGAGCAAC
>probe:Drosophila_2:1631484_at:402:511; Interrogation_Position=385; Antisense; GTGAGCAACCAACCTGTTCGATCAA
>probe:Drosophila_2:1631484_at:109:39; Interrogation_Position=428; Antisense; ATCCAAAACTGGCTCCCAAGGAGGT
>probe:Drosophila_2:1631484_at:382:527; Interrogation_Position=464; Antisense; GGGAACTCATCTTCAAGGATCTTAA
>probe:Drosophila_2:1631484_at:110:439; Interrogation_Position=490; Antisense; GAGGCGCGAGCTGCCAAGGAACCAA
>probe:Drosophila_2:1631484_at:378:413; Interrogation_Position=537; Antisense; GACCAAAGACCAGCAGGATCCCAAG
>probe:Drosophila_2:1631484_at:223:507; Interrogation_Position=580; Antisense; GTGCCCAAGGAACCCAAGGATCTGA
>probe:Drosophila_2:1631484_at:681:223; Interrogation_Position=604; Antisense; AAGGCAAGTGGAGCCCGCCAGAACA
>probe:Drosophila_2:1631484_at:404:557; Interrogation_Position=650; Antisense; TCGACAAGTACCTGAAGTTCGCCTT
>probe:Drosophila_2:1631484_at:685:373; Interrogation_Position=663; Antisense; GAAGTTCGCCTTTGATCTGAGCACT
>probe:Drosophila_2:1631484_at:303:607; Interrogation_Position=680; Antisense; TGAGCACTCCCGATGGTATCCAGAA
>probe:Drosophila_2:1631484_at:555:581; Interrogation_Position=747; Antisense; TGGCGTCTCAAACTCTAACAGGGAA
>probe:Drosophila_2:1631484_at:519:513; Interrogation_Position=811; Antisense; GTGATCTTGAAGGATTCATGCCCAA
>probe:Drosophila_2:1631484_at:216:193; Interrogation_Position=928; Antisense; AACTCGGTCGATTTCTCTTTATACT

Paste this into a BLAST search page for me
CCAGAGCGCGGTTAGTGTGAGCAACGTGAGCAACCAACCTGTTCGATCAAATCCAAAACTGGCTCCCAAGGAGGTGGGAACTCATCTTCAAGGATCTTAAGAGGCGCGAGCTGCCAAGGAACCAAGACCAAAGACCAGCAGGATCCCAAGGTGCCCAAGGAACCCAAGGATCTGAAAGGCAAGTGGAGCCCGCCAGAACATCGACAAGTACCTGAAGTTCGCCTTGAAGTTCGCCTTTGATCTGAGCACTTGAGCACTCCCGATGGTATCCAGAATGGCGTCTCAAACTCTAACAGGGAAGTGATCTTGAAGGATTCATGCCCAAAACTCGGTCGATTTCTCTTTATACT

Full Affymetrix probeset data:

Annotations for 1631484_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720