Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631487_s_at:

>probe:Drosophila_2:1631487_s_at:703:231; Interrogation_Position=118; Antisense; AATGCGGCCGGTCCGCTGGGCAGCA
>probe:Drosophila_2:1631487_s_at:427:597; Interrogation_Position=14; Antisense; TGTCGTACCGCGGAATGCTGAGCAC
>probe:Drosophila_2:1631487_s_at:398:61; Interrogation_Position=178; Antisense; ATGTCCATGCCCCAAAAGCCGAGTT
>probe:Drosophila_2:1631487_s_at:715:203; Interrogation_Position=193; Antisense; AAGCCGAGTTCCCTAAGGGCGACAT
>probe:Drosophila_2:1631487_s_at:259:717; Interrogation_Position=201; Antisense; TTCCCTAAGGGCGACATGTAAGTCG
>probe:Drosophila_2:1631487_s_at:107:565; Interrogation_Position=25; Antisense; GGAATGCTGAGCACCTCGGACGGTT
>probe:Drosophila_2:1631487_s_at:335:51; Interrogation_Position=28; Antisense; ATGCTGAGCACCTCGGACGGTTCGC
>probe:Drosophila_2:1631487_s_at:471:139; Interrogation_Position=44; Antisense; ACGGTTCGCCCGTCGAGCTGCGCGT
>probe:Drosophila_2:1631487_s_at:528:119; Interrogation_Position=59; Antisense; AGCTGCGCGTCCAGGATGTGGACTC
>probe:Drosophila_2:1631487_s_at:654:441; Interrogation_Position=73; Antisense; GATGTGGACTCCTTTGACGGATCGA
>probe:Drosophila_2:1631487_s_at:451:585; Interrogation_Position=77; Antisense; TGGACTCCTTTGACGGATCGATGAT
>probe:Drosophila_2:1631487_s_at:476:725; Interrogation_Position=86; Antisense; TTGACGGATCGATGATGTCCCATGC
>probe:Drosophila_2:1631487_s_at:11:547; Interrogation_Position=91; Antisense; GGATCGATGATGTCCCATGCGGCCA
>probe:Drosophila_2:1631487_s_at:226:57; Interrogation_Position=97; Antisense; ATGATGTCCCATGCGGCCACCAATG

Paste this into a BLAST search page for me
AATGCGGCCGGTCCGCTGGGCAGCATGTCGTACCGCGGAATGCTGAGCACATGTCCATGCCCCAAAAGCCGAGTTAAGCCGAGTTCCCTAAGGGCGACATTTCCCTAAGGGCGACATGTAAGTCGGGAATGCTGAGCACCTCGGACGGTTATGCTGAGCACCTCGGACGGTTCGCACGGTTCGCCCGTCGAGCTGCGCGTAGCTGCGCGTCCAGGATGTGGACTCGATGTGGACTCCTTTGACGGATCGATGGACTCCTTTGACGGATCGATGATTTGACGGATCGATGATGTCCCATGCGGATCGATGATGTCCCATGCGGCCAATGATGTCCCATGCGGCCACCAATG

Full Affymetrix probeset data:

Annotations for 1631487_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime