FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631488_at:

>probe:Drosophila_2:1631488_at:658:351; Interrogation_Position=4743; Antisense; GCAGCGACTTGTGCATCCTGGCCAA
>probe:Drosophila_2:1631488_at:571:35; Interrogation_Position=4784; Antisense; ATCAGGCTGCCGAGCTGTGCGATTC
>probe:Drosophila_2:1631488_at:182:35; Interrogation_Position=4820; Antisense; ATCACCTGCGTGATCAACTGGTTGC
>probe:Drosophila_2:1631488_at:225:401; Interrogation_Position=4861; Antisense; GACATTGGGTTGGTCGGACGCTTTA
>probe:Drosophila_2:1631488_at:345:411; Interrogation_Position=4877; Antisense; GACGCTTTAGTGGACTGGTGCTGCT
>probe:Drosophila_2:1631488_at:77:507; Interrogation_Position=5033; Antisense; GTGCCTTGATACCACCATTCTTGGA
>probe:Drosophila_2:1631488_at:338:273; Interrogation_Position=5048; Antisense; CATTCTTGGACACCATGATCGGTAA
>probe:Drosophila_2:1631488_at:93:539; Interrogation_Position=5068; Antisense; GGTAAGCTGACCTTCGATGACTTCA
>probe:Drosophila_2:1631488_at:528:403; Interrogation_Position=5086; Antisense; GACTTCAACATGGTACAGCGCCTGG
>probe:Drosophila_2:1631488_at:345:589; Interrogation_Position=5108; Antisense; TGGTTGACATCATCGCTGAGCCCTT
>probe:Drosophila_2:1631488_at:456:145; Interrogation_Position=5134; Antisense; ACTACCGCCGATGCAATGGAGCTGT
>probe:Drosophila_2:1631488_at:159:77; Interrogation_Position=5168; Antisense; AGGAGAACAACCATTACTGCGAAAG
>probe:Drosophila_2:1631488_at:129:561; Interrogation_Position=5192; Antisense; GGAACCACGTTTTAACCGAGCTATG
>probe:Drosophila_2:1631488_at:711:555; Interrogation_Position=5227; Antisense; GGACGAGCAGATCCACGTGCAAGAA

Paste this into a BLAST search page for me
GCAGCGACTTGTGCATCCTGGCCAAATCAGGCTGCCGAGCTGTGCGATTCATCACCTGCGTGATCAACTGGTTGCGACATTGGGTTGGTCGGACGCTTTAGACGCTTTAGTGGACTGGTGCTGCTGTGCCTTGATACCACCATTCTTGGACATTCTTGGACACCATGATCGGTAAGGTAAGCTGACCTTCGATGACTTCAGACTTCAACATGGTACAGCGCCTGGTGGTTGACATCATCGCTGAGCCCTTACTACCGCCGATGCAATGGAGCTGTAGGAGAACAACCATTACTGCGAAAGGGAACCACGTTTTAACCGAGCTATGGGACGAGCAGATCCACGTGCAAGAA

Full Affymetrix probeset data:

Annotations for 1631488_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720