FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631491_at:

>probe:Drosophila_2:1631491_at:236:601; Interrogation_Position=1056; Antisense; TGTAAAGAACACAAGCCCTCACCTA
>probe:Drosophila_2:1631491_at:649:321; Interrogation_Position=1070; Antisense; GCCCTCACCTATGTAATTATCTCAG
>probe:Drosophila_2:1631491_at:228:289; Interrogation_Position=562; Antisense; CGGATATTCTGCGAGGACTGCCTCA
>probe:Drosophila_2:1631491_at:385:293; Interrogation_Position=588; Antisense; CGATCGCTGCAACGGAGCCTTAGCA
>probe:Drosophila_2:1631491_at:655:125; Interrogation_Position=603; Antisense; AGCCTTAGCAGGTGCATCCATTTTG
>probe:Drosophila_2:1631491_at:105:49; Interrogation_Position=618; Antisense; ATCCATTTTGGAGATGCTGCTGCTC
>probe:Drosophila_2:1631491_at:671:43; Interrogation_Position=649; Antisense; ATCGCGGGCCTCATCCAACAGTTTG
>probe:Drosophila_2:1631491_at:716:213; Interrogation_Position=686; Antisense; AAGATCCCCAGGTCGATTTTCAGTT
>probe:Drosophila_2:1631491_at:452:383; Interrogation_Position=712; Antisense; GAACGTGATATTTTGCCTGGCTCTC
>probe:Drosophila_2:1631491_at:417:523; Interrogation_Position=737; Antisense; GGGCCGAGCTGTTGCTGATTTACAT
>probe:Drosophila_2:1631491_at:533:17; Interrogation_Position=754; Antisense; ATTTACATTTGCGTTTAGCTCGAAT
>probe:Drosophila_2:1631491_at:481:685; Interrogation_Position=856; Antisense; TATAGTTTGCCTGGCCGAGTGCCGA
>probe:Drosophila_2:1631491_at:351:433; Interrogation_Position=872; Antisense; GAGTGCCGATGTTTGCCAAGCTCAA
>probe:Drosophila_2:1631491_at:500:207; Interrogation_Position=889; Antisense; AAGCTCAAAGCTCAAATTCCGAATG

Paste this into a BLAST search page for me
TGTAAAGAACACAAGCCCTCACCTAGCCCTCACCTATGTAATTATCTCAGCGGATATTCTGCGAGGACTGCCTCACGATCGCTGCAACGGAGCCTTAGCAAGCCTTAGCAGGTGCATCCATTTTGATCCATTTTGGAGATGCTGCTGCTCATCGCGGGCCTCATCCAACAGTTTGAAGATCCCCAGGTCGATTTTCAGTTGAACGTGATATTTTGCCTGGCTCTCGGGCCGAGCTGTTGCTGATTTACATATTTACATTTGCGTTTAGCTCGAATTATAGTTTGCCTGGCCGAGTGCCGAGAGTGCCGATGTTTGCCAAGCTCAAAAGCTCAAAGCTCAAATTCCGAATG

Full Affymetrix probeset data:

Annotations for 1631491_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720