Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631492_at:

>probe:Drosophila_2:1631492_at:82:547; Interrogation_Position=1019; Antisense; GGATGCCTTCTTTAACCATAACTTT
>probe:Drosophila_2:1631492_at:154:227; Interrogation_Position=1046; Antisense; AAGGCAGCGCTTGAGGCATCTGCGA
>probe:Drosophila_2:1631492_at:146:467; Interrogation_Position=1109; Antisense; GTTGAAGCATAATCTCGACCTGGTA
>probe:Drosophila_2:1631492_at:603:545; Interrogation_Position=1153; Antisense; GGATCTATATGCCACGGATGCCCAA
>probe:Drosophila_2:1631492_at:176:105; Interrogation_Position=1213; Antisense; AGACGCAGCTTCACATACGCAATGC
>probe:Drosophila_2:1631492_at:683:361; Interrogation_Position=1231; Antisense; GCAATGCGAAGGACACAGCCCATAA
>probe:Drosophila_2:1631492_at:559:247; Interrogation_Position=1276; Antisense; AATTGGTCAAGGGATCGCCCACACT
>probe:Drosophila_2:1631492_at:29:593; Interrogation_Position=1300; Antisense; TGGTGGCAAACAGCTCCTCGACAAG
>probe:Drosophila_2:1631492_at:371:589; Interrogation_Position=1331; Antisense; TGGATTCGTCATGAGTCACACCGTC
>probe:Drosophila_2:1631492_at:232:157; Interrogation_Position=1348; Antisense; ACACCGTCCAATCGTTTGCAGAAAG
>probe:Drosophila_2:1631492_at:343:121; Interrogation_Position=1382; Antisense; AGCGGAGCTTCCCTATAATTATATG
>probe:Drosophila_2:1631492_at:319:695; Interrogation_Position=1481; Antisense; TTTCCACGAGCTACGATCCACAATG
>probe:Drosophila_2:1631492_at:293:539; Interrogation_Position=1505; Antisense; GGTATTACTCCTTCTTGTTTTTCAG
>probe:Drosophila_2:1631492_at:399:155; Interrogation_Position=1566; Antisense; ACACCACATTAGCAGCACGTTCAAT

Paste this into a BLAST search page for me
GGATGCCTTCTTTAACCATAACTTTAAGGCAGCGCTTGAGGCATCTGCGAGTTGAAGCATAATCTCGACCTGGTAGGATCTATATGCCACGGATGCCCAAAGACGCAGCTTCACATACGCAATGCGCAATGCGAAGGACACAGCCCATAAAATTGGTCAAGGGATCGCCCACACTTGGTGGCAAACAGCTCCTCGACAAGTGGATTCGTCATGAGTCACACCGTCACACCGTCCAATCGTTTGCAGAAAGAGCGGAGCTTCCCTATAATTATATGTTTCCACGAGCTACGATCCACAATGGGTATTACTCCTTCTTGTTTTTCAGACACCACATTAGCAGCACGTTCAAT

Full Affymetrix probeset data:

Annotations for 1631492_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime