FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631493_at:

>probe:Drosophila_2:1631493_at:299:95; Interrogation_Position=1001; Antisense; AGATTGGTGGAACTCCCATCATCGG
>probe:Drosophila_2:1631493_at:252:497; Interrogation_Position=1028; Antisense; GTCAGTATGTGGTTTCTTGCGATCT
>probe:Drosophila_2:1631493_at:471:645; Interrogation_Position=1052; Antisense; TCATTCCCCAATTGCCGGTAATCAA
>probe:Drosophila_2:1631493_at:265:725; Interrogation_Position=1079; Antisense; TTGTGCTGGGCGGAAAGACCTTCGA
>probe:Drosophila_2:1631493_at:54:225; Interrogation_Position=1114; Antisense; AAGGACTATATTCTCCGTGTGGCCC
>probe:Drosophila_2:1631493_at:414:213; Interrogation_Position=1147; Antisense; AAGACCATCTGTCTGTCCGGCTTTA
>probe:Drosophila_2:1631493_at:22:1; Interrogation_Position=1195; Antisense; AACGGACCCTTGTGGATCCTCGGTG
>probe:Drosophila_2:1631493_at:264:631; Interrogation_Position=1211; Antisense; TCCTCGGTGACGTTTTCATTGGCAA
>probe:Drosophila_2:1631493_at:115:517; Interrogation_Position=1270; Antisense; GTGGGCTTCGCCGATGCCAAATAAT
>probe:Drosophila_2:1631493_at:727:13; Interrogation_Position=1334; Antisense; ATTATCGATCGATCCCATTGCGGGT
>probe:Drosophila_2:1631493_at:245:527; Interrogation_Position=832; Antisense; GGTGAATTCACCTACTTGCCCGTTA
>probe:Drosophila_2:1631493_at:223:629; Interrogation_Position=895; Antisense; TCCATTGGCGATTTGCAGCTGTGCA
>probe:Drosophila_2:1631493_at:634:647; Interrogation_Position=955; Antisense; TCACTAATTGCTGCGCCCTTGGAAG
>probe:Drosophila_2:1631493_at:523:437; Interrogation_Position=979; Antisense; GAGGCCACCTCTATTAACCAGAAGA

Paste this into a BLAST search page for me
AGATTGGTGGAACTCCCATCATCGGGTCAGTATGTGGTTTCTTGCGATCTTCATTCCCCAATTGCCGGTAATCAATTGTGCTGGGCGGAAAGACCTTCGAAAGGACTATATTCTCCGTGTGGCCCAAGACCATCTGTCTGTCCGGCTTTAAACGGACCCTTGTGGATCCTCGGTGTCCTCGGTGACGTTTTCATTGGCAAGTGGGCTTCGCCGATGCCAAATAATATTATCGATCGATCCCATTGCGGGTGGTGAATTCACCTACTTGCCCGTTATCCATTGGCGATTTGCAGCTGTGCATCACTAATTGCTGCGCCCTTGGAAGGAGGCCACCTCTATTAACCAGAAGA

Full Affymetrix probeset data:

Annotations for 1631493_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720