Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631496_at:

>probe:Drosophila_2:1631496_at:537:79; Interrogation_Position=1180; Antisense; AGGTGCTCATCGACATCGGCCTGAA
>probe:Drosophila_2:1631496_at:90:431; Interrogation_Position=1209; Antisense; GAGGGCTACCTCTCGAACCCGGAGG
>probe:Drosophila_2:1631496_at:4:67; Interrogation_Position=1255; Antisense; ATGGATGGATCAACCTGGGCGACCT
>probe:Drosophila_2:1631496_at:283:185; Interrogation_Position=1299; Antisense; AACAACCTGTACTTGGTGGACCGCA
>probe:Drosophila_2:1631496_at:728:89; Interrogation_Position=1339; Antisense; AGTACAAGTCCAAGCACTACTGGCC
>probe:Drosophila_2:1631496_at:661:317; Interrogation_Position=1452; Antisense; GCCGGAGCCCTGATCATCAAGAAGG
>probe:Drosophila_2:1631496_at:659:109; Interrogation_Position=1498; Antisense; AGAAGGTCATCGACCACGTGGCCCA
>probe:Drosophila_2:1631496_at:698:591; Interrogation_Position=1528; Antisense; TGGTGGTGGACTACAAGCAGCTGAA
>probe:Drosophila_2:1631496_at:498:613; Interrogation_Position=1549; Antisense; TGAATGCCGGAGTCATCTTCGTGGA
>probe:Drosophila_2:1631496_at:174:37; Interrogation_Position=1563; Antisense; ATCTTCGTGGACAAGTTCCCCAAGA
>probe:Drosophila_2:1631496_at:332:133; Interrogation_Position=1588; Antisense; ACGCCAACGGCAAGGTCATGAGGAG
>probe:Drosophila_2:1631496_at:195:515; Interrogation_Position=1626; Antisense; GTGTTCGAGAAAACCAAGCCCATTA
>probe:Drosophila_2:1631496_at:101:273; Interrogation_Position=1646; Antisense; CATTACCTTCTAACACCTACAATCA
>probe:Drosophila_2:1631496_at:529:93; Interrogation_Position=1721; Antisense; AGTTCTTGTTGCTTGTTGTTAATTC

Paste this into a BLAST search page for me
AGGTGCTCATCGACATCGGCCTGAAGAGGGCTACCTCTCGAACCCGGAGGATGGATGGATCAACCTGGGCGACCTAACAACCTGTACTTGGTGGACCGCAAGTACAAGTCCAAGCACTACTGGCCGCCGGAGCCCTGATCATCAAGAAGGAGAAGGTCATCGACCACGTGGCCCATGGTGGTGGACTACAAGCAGCTGAATGAATGCCGGAGTCATCTTCGTGGAATCTTCGTGGACAAGTTCCCCAAGAACGCCAACGGCAAGGTCATGAGGAGGTGTTCGAGAAAACCAAGCCCATTACATTACCTTCTAACACCTACAATCAAGTTCTTGTTGCTTGTTGTTAATTC

Full Affymetrix probeset data:

Annotations for 1631496_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime