Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631497_at:

>probe:Drosophila_2:1631497_at:5:229; Interrogation_Position=332; Antisense; AATGGCAGGTGCTCTGATCTTGGCC
>probe:Drosophila_2:1631497_at:41:531; Interrogation_Position=374; Antisense; GGGTGCCATATTCGGTTCCATCAAG
>probe:Drosophila_2:1631497_at:532:511; Interrogation_Position=408; Antisense; GTGAACTTGATTCTGCTTCTGGCTC
>probe:Drosophila_2:1631497_at:409:605; Interrogation_Position=433; Antisense; TGATAGCCTCGCACATCTGGAAGGT
>probe:Drosophila_2:1631497_at:62:373; Interrogation_Position=452; Antisense; GAAGGTGTCCCACTACAATGAGACC
>probe:Drosophila_2:1631497_at:313:585; Interrogation_Position=484; Antisense; TGGACGCCACTGAGGTGTACGTGAT
>probe:Drosophila_2:1631497_at:56:581; Interrogation_Position=578; Antisense; TGGCGACAAGGGATTCTCCGACTAC
>probe:Drosophila_2:1631497_at:306:153; Interrogation_Position=613; Antisense; ACATGAAGGTGCCTCGCAGCTGTTT
>probe:Drosophila_2:1631497_at:637:343; Interrogation_Position=652; Antisense; GCATTCACGCCTTGTATCCGTATGG
>probe:Drosophila_2:1631497_at:344:613; Interrogation_Position=697; Antisense; TGAAGCGGGCTTATCTGCAGATCTA
>probe:Drosophila_2:1631497_at:653:143; Interrogation_Position=742; Antisense; ACTGCGGACTTATTGGCTACGAGGT
>probe:Drosophila_2:1631497_at:576:671; Interrogation_Position=759; Antisense; TACGAGGTCGTAGGCATCATCTTGG
>probe:Drosophila_2:1631497_at:179:37; Interrogation_Position=774; Antisense; ATCATCTTGGGTATCACCTTGTGCT
>probe:Drosophila_2:1631497_at:470:729; Interrogation_Position=792; Antisense; TTGTGCTGCCAGCTGACCAACAAGA

Paste this into a BLAST search page for me
AATGGCAGGTGCTCTGATCTTGGCCGGGTGCCATATTCGGTTCCATCAAGGTGAACTTGATTCTGCTTCTGGCTCTGATAGCCTCGCACATCTGGAAGGTGAAGGTGTCCCACTACAATGAGACCTGGACGCCACTGAGGTGTACGTGATTGGCGACAAGGGATTCTCCGACTACACATGAAGGTGCCTCGCAGCTGTTTGCATTCACGCCTTGTATCCGTATGGTGAAGCGGGCTTATCTGCAGATCTAACTGCGGACTTATTGGCTACGAGGTTACGAGGTCGTAGGCATCATCTTGGATCATCTTGGGTATCACCTTGTGCTTTGTGCTGCCAGCTGACCAACAAGA

Full Affymetrix probeset data:

Annotations for 1631497_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime