Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631500_at:

>probe:Drosophila_2:1631500_at:280:265; Interrogation_Position=1364; Antisense; CAGAGGCTCAAGGTACCTCACATTT
>probe:Drosophila_2:1631500_at:107:487; Interrogation_Position=1376; Antisense; GTACCTCACATTTGGCCACTTTTAG
>probe:Drosophila_2:1631500_at:22:311; Interrogation_Position=1390; Antisense; GCCACTTTTAGTTGCACCCGGAAGA
>probe:Drosophila_2:1631500_at:594:677; Interrogation_Position=1398; Antisense; TAGTTGCACCCGGAAGAAAAAGCGT
>probe:Drosophila_2:1631500_at:318:329; Interrogation_Position=1419; Antisense; GCGTAAGCTGGTAATCGACAGACAT
>probe:Drosophila_2:1631500_at:440:607; Interrogation_Position=1443; Antisense; TGAGTTTGTCATGGATCGGAAGCTG
>probe:Drosophila_2:1631500_at:548:113; Interrogation_Position=1471; Antisense; AGCAGCATCAACTGGCGGTGTGCCA
>probe:Drosophila_2:1631500_at:541:533; Interrogation_Position=1487; Antisense; GGTGTGCCAGGTATCGAAGTTCGAA
>probe:Drosophila_2:1631500_at:725:469; Interrogation_Position=1505; Antisense; GTTCGAACTGCAAGGTCAGGGCCAC
>probe:Drosophila_2:1631500_at:585:579; Interrogation_Position=1524; Antisense; GGCCACCACCCACGTGCAGAAGAAT
>probe:Drosophila_2:1631500_at:114:229; Interrogation_Position=1546; Antisense; AATGGACTGGAGGTGTACCGACTGA
>probe:Drosophila_2:1631500_at:525:487; Interrogation_Position=1560; Antisense; GTACCGACTGAAATATGCGAAGCAC
>probe:Drosophila_2:1631500_at:370:243; Interrogation_Position=1571; Antisense; AATATGCGAAGCACTCGCACCTGTG
>probe:Drosophila_2:1631500_at:462:259; Interrogation_Position=1582; Antisense; CACTCGCACCTGTGACCTAAGAAAA

Paste this into a BLAST search page for me
CAGAGGCTCAAGGTACCTCACATTTGTACCTCACATTTGGCCACTTTTAGGCCACTTTTAGTTGCACCCGGAAGATAGTTGCACCCGGAAGAAAAAGCGTGCGTAAGCTGGTAATCGACAGACATTGAGTTTGTCATGGATCGGAAGCTGAGCAGCATCAACTGGCGGTGTGCCAGGTGTGCCAGGTATCGAAGTTCGAAGTTCGAACTGCAAGGTCAGGGCCACGGCCACCACCCACGTGCAGAAGAATAATGGACTGGAGGTGTACCGACTGAGTACCGACTGAAATATGCGAAGCACAATATGCGAAGCACTCGCACCTGTGCACTCGCACCTGTGACCTAAGAAAA

Full Affymetrix probeset data:

Annotations for 1631500_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime