FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631502_at:

>probe:Drosophila_2:1631502_at:168:111; Interrogation_Position=1684; Antisense; AGCAGCACCTCCAGGTCTACGAGGA
>probe:Drosophila_2:1631502_at:67:437; Interrogation_Position=1704; Antisense; GAGGAGGGACACAATCCACACCAAC
>probe:Drosophila_2:1631502_at:24:127; Interrogation_Position=1723; Antisense; ACCAACTCTACTACGCCGGCAGTGT
>probe:Drosophila_2:1631502_at:33:525; Interrogation_Position=1780; Antisense; GGGAATACCAAATGCAACCACCGGC
>probe:Drosophila_2:1631502_at:637:251; Interrogation_Position=1794; Antisense; CAACCACCGGCCATTTATTAATCTT
>probe:Drosophila_2:1631502_at:668:495; Interrogation_Position=1820; Antisense; GTCAGTTTAGCCAAAGTCAGAAGTC
>probe:Drosophila_2:1631502_at:180:721; Interrogation_Position=1891; Antisense; TTGCCTCTTAGGGTCTCTAGTTTAT
>probe:Drosophila_2:1631502_at:107:273; Interrogation_Position=1959; Antisense; CATATCGCAGTTGAGAGCTTAGCAT
>probe:Drosophila_2:1631502_at:117:477; Interrogation_Position=1990; Antisense; GTTTTCGTTGACAATTCCTTGTATT
>probe:Drosophila_2:1631502_at:453:471; Interrogation_Position=2018; Antisense; GTTCGTTGTTAAAACTCATTCGTGT
>probe:Drosophila_2:1631502_at:61:81; Interrogation_Position=2054; Antisense; AGGTGCCAGATAATTAAGCCCCAAT
>probe:Drosophila_2:1631502_at:220:13; Interrogation_Position=2066; Antisense; ATTAAGCCCCAATTCATACGACATA
>probe:Drosophila_2:1631502_at:167:639; Interrogation_Position=2079; Antisense; TCATACGACATACCTACCAACTTAT
>probe:Drosophila_2:1631502_at:430:371; Interrogation_Position=2164; Antisense; GAAGGTAGCCATTTACTTGCATGTA

Paste this into a BLAST search page for me
AGCAGCACCTCCAGGTCTACGAGGAGAGGAGGGACACAATCCACACCAACACCAACTCTACTACGCCGGCAGTGTGGGAATACCAAATGCAACCACCGGCCAACCACCGGCCATTTATTAATCTTGTCAGTTTAGCCAAAGTCAGAAGTCTTGCCTCTTAGGGTCTCTAGTTTATCATATCGCAGTTGAGAGCTTAGCATGTTTTCGTTGACAATTCCTTGTATTGTTCGTTGTTAAAACTCATTCGTGTAGGTGCCAGATAATTAAGCCCCAATATTAAGCCCCAATTCATACGACATATCATACGACATACCTACCAACTTATGAAGGTAGCCATTTACTTGCATGTA

Full Affymetrix probeset data:

Annotations for 1631502_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720