FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631503_at:

>probe:Drosophila_2:1631503_at:144:331; Interrogation_Position=117; Antisense; GCGGTGTGGCGCAGACTTTCAGAAC
>probe:Drosophila_2:1631503_at:153:383; Interrogation_Position=138; Antisense; GAACGAAGTGTTTACTCTACTCCAT
>probe:Drosophila_2:1631503_at:362:339; Interrogation_Position=153; Antisense; TCTACTCCATTTGGCCGAAACAGTC
>probe:Drosophila_2:1631503_at:631:47; Interrogation_Position=211; Antisense; ATCCTTTTGAGTGCGGCCTGTGCAA
>probe:Drosophila_2:1631503_at:86:83; Interrogation_Position=259; Antisense; AGGGAGCAGCGCCAAATGTCAAGTA
>probe:Drosophila_2:1631503_at:158:487; Interrogation_Position=281; Antisense; GTAGCCGTCAATTGGACAGTACGAC
>probe:Drosophila_2:1631503_at:130:265; Interrogation_Position=314; Antisense; CAGAAGCTGTCTGGGCGGTAAGCAT
>probe:Drosophila_2:1631503_at:556:589; Interrogation_Position=344; Antisense; TGGATTTCATCGCATATCCGCACAT
>probe:Drosophila_2:1631503_at:417:121; Interrogation_Position=37; Antisense; AGCGCATCAACCCTGAACCGAGGAA
>probe:Drosophila_2:1631503_at:150:273; Interrogation_Position=377; Antisense; CATATCCTCATGTTTTCTTTTCAGA
>probe:Drosophila_2:1631503_at:554:683; Interrogation_Position=409; Antisense; TATAATTGCCATCAGGCTGCCAGGC
>probe:Drosophila_2:1631503_at:279:549; Interrogation_Position=453; Antisense; GGAGGACACTTCATCTACAGCCAGA
>probe:Drosophila_2:1631503_at:80:157; Interrogation_Position=469; Antisense; ACAGCCAGAGTGTTTGCCTATCCAA
>probe:Drosophila_2:1631503_at:524:413; Interrogation_Position=547; Antisense; GACCAGGAGAGACCCAGTCCGGAAT

Paste this into a BLAST search page for me
GCGGTGTGGCGCAGACTTTCAGAACGAACGAAGTGTTTACTCTACTCCATTCTACTCCATTTGGCCGAAACAGTCATCCTTTTGAGTGCGGCCTGTGCAAAGGGAGCAGCGCCAAATGTCAAGTAGTAGCCGTCAATTGGACAGTACGACCAGAAGCTGTCTGGGCGGTAAGCATTGGATTTCATCGCATATCCGCACATAGCGCATCAACCCTGAACCGAGGAACATATCCTCATGTTTTCTTTTCAGATATAATTGCCATCAGGCTGCCAGGCGGAGGACACTTCATCTACAGCCAGAACAGCCAGAGTGTTTGCCTATCCAAGACCAGGAGAGACCCAGTCCGGAAT

Full Affymetrix probeset data:

Annotations for 1631503_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720