FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631505_at:

>probe:Drosophila_2:1631505_at:31:519; Interrogation_Position=384; Antisense; GTGGATCATCAAGCTGGGAACCTGT
>probe:Drosophila_2:1631505_at:391:645; Interrogation_Position=408; Antisense; TCAGTTGGCCAACAGCGTCGGTGAC
>probe:Drosophila_2:1631505_at:5:611; Interrogation_Position=429; Antisense; TGACCATTCCTGTGACTTCGAACGT
>probe:Drosophila_2:1631505_at:168:509; Interrogation_Position=512; Antisense; GTGCTGCGGCAGATTTTCTCAAAGA
>probe:Drosophila_2:1631505_at:481:453; Interrogation_Position=553; Antisense; GATCACACATTCCAGAGCGACGTCG
>probe:Drosophila_2:1631505_at:114:75; Interrogation_Position=579; Antisense; AGGACACTTTATTCGCTTGCAATCG
>probe:Drosophila_2:1631505_at:390:235; Interrogation_Position=599; Antisense; AATCGCAGGTACACGCTTCCAGAAC
>probe:Drosophila_2:1631505_at:165:519; Interrogation_Position=666; Antisense; GGGCCATTCCTTATGGTTTCAGTTC
>probe:Drosophila_2:1631505_at:109:211; Interrogation_Position=717; Antisense; AAGAAACCTGACGATCTCCGTGAAA
>probe:Drosophila_2:1631505_at:471:105; Interrogation_Position=781; Antisense; AGAAATATCTGCACCAAACTCACCG
>probe:Drosophila_2:1631505_at:210:179; Interrogation_Position=796; Antisense; AAACTCACCGTGTCTGGCGATCAAG
>probe:Drosophila_2:1631505_at:167:431; Interrogation_Position=862; Antisense; GAGTCGGACTTCCAGGTGGTCTTCA
>probe:Drosophila_2:1631505_at:116:519; Interrogation_Position=877; Antisense; GTGGTCTTCACAGTCGTGGACCCAA
>probe:Drosophila_2:1631505_at:716:585; Interrogation_Position=893; Antisense; TGGACCCAAGTTCTCTCCATGGAGA

Paste this into a BLAST search page for me
GTGGATCATCAAGCTGGGAACCTGTTCAGTTGGCCAACAGCGTCGGTGACTGACCATTCCTGTGACTTCGAACGTGTGCTGCGGCAGATTTTCTCAAAGAGATCACACATTCCAGAGCGACGTCGAGGACACTTTATTCGCTTGCAATCGAATCGCAGGTACACGCTTCCAGAACGGGCCATTCCTTATGGTTTCAGTTCAAGAAACCTGACGATCTCCGTGAAAAGAAATATCTGCACCAAACTCACCGAAACTCACCGTGTCTGGCGATCAAGGAGTCGGACTTCCAGGTGGTCTTCAGTGGTCTTCACAGTCGTGGACCCAATGGACCCAAGTTCTCTCCATGGAGA

Full Affymetrix probeset data:

Annotations for 1631505_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720