FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631512_at:

>probe:Drosophila_2:1631512_at:64:67; Interrogation_Position=1018; Antisense; ATGGCCCGCAACTTCTTGGAATTTA
>probe:Drosophila_2:1631512_at:573:193; Interrogation_Position=1047; Antisense; AACGTCAAGTTGTACCGGCAGTGGA
>probe:Drosophila_2:1631512_at:672:607; Interrogation_Position=581; Antisense; TGAGACATTAGTGCATCCCAATTAC
>probe:Drosophila_2:1631512_at:479:49; Interrogation_Position=612; Antisense; ATGCCATTGGCCCACAACATAGCGA
>probe:Drosophila_2:1631512_at:729:189; Interrogation_Position=627; Antisense; AACATAGCGATACTTCTGGTGGACA
>probe:Drosophila_2:1631512_at:293:225; Interrogation_Position=651; Antisense; AAGGAGAAACCTTTCCAGCTGGCTC
>probe:Drosophila_2:1631512_at:368:657; Interrogation_Position=677; Antisense; TAATGTACAGCCCATTTGCTTGCCG
>probe:Drosophila_2:1631512_at:41:301; Interrogation_Position=700; Antisense; CGCCTCCGCGAATAATGTACAACTA
>probe:Drosophila_2:1631512_at:170:157; Interrogation_Position=724; Antisense; ACAGCCAGTGCTATGTGTCCGGTTG
>probe:Drosophila_2:1631512_at:292:257; Interrogation_Position=811; Antisense; CACCCGATCAATGCAGGACCAAGTT
>probe:Drosophila_2:1631512_at:478:413; Interrogation_Position=827; Antisense; GACCAAGTTGCGATTGTCCCTCTTG
>probe:Drosophila_2:1631512_at:39:161; Interrogation_Position=868; Antisense; ACAACGATAGCCTGCTGTGTGCCGG
>probe:Drosophila_2:1631512_at:438:159; Interrogation_Position=898; Antisense; ACAAGGGTGACTTCGTCTGCGGTGA
>probe:Drosophila_2:1631512_at:368:513; Interrogation_Position=919; Antisense; GTGATGTGGACATGACCGCTGTGCC

Paste this into a BLAST search page for me
ATGGCCCGCAACTTCTTGGAATTTAAACGTCAAGTTGTACCGGCAGTGGATGAGACATTAGTGCATCCCAATTACATGCCATTGGCCCACAACATAGCGAAACATAGCGATACTTCTGGTGGACAAAGGAGAAACCTTTCCAGCTGGCTCTAATGTACAGCCCATTTGCTTGCCGCGCCTCCGCGAATAATGTACAACTAACAGCCAGTGCTATGTGTCCGGTTGCACCCGATCAATGCAGGACCAAGTTGACCAAGTTGCGATTGTCCCTCTTGACAACGATAGCCTGCTGTGTGCCGGACAAGGGTGACTTCGTCTGCGGTGAGTGATGTGGACATGACCGCTGTGCC

Full Affymetrix probeset data:

Annotations for 1631512_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720