FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631513_at:

>probe:Drosophila_2:1631513_at:8:85; Interrogation_Position=414; Antisense; AGTGGCAGCATTTCAATGTCCGCTT
>probe:Drosophila_2:1631513_at:291:649; Interrogation_Position=460; Antisense; TCAGGTGTGGCTTCTTCCGGCAAAG
>probe:Drosophila_2:1631513_at:492:243; Interrogation_Position=545; Antisense; AATTTGGGTCTACTGGAACGCCTCT
>probe:Drosophila_2:1631513_at:498:387; Interrogation_Position=575; Antisense; GAAAAGGACTTCTTAGTCGGCGACA
>probe:Drosophila_2:1631513_at:527:573; Interrogation_Position=593; Antisense; GGCGACAAACTTACCGTGGCAGACA
>probe:Drosophila_2:1631513_at:709:583; Interrogation_Position=609; Antisense; TGGCAGACATCTTCGGGTCTTCAGA
>probe:Drosophila_2:1631513_at:398:55; Interrogation_Position=644; Antisense; ATGAAGCTCTGCCAGTACAACGTAA
>probe:Drosophila_2:1631513_at:721:375; Interrogation_Position=673; Antisense; GAAGCAATTCCCCAAGGTGGCCAAG
>probe:Drosophila_2:1631513_at:708:561; Interrogation_Position=703; Antisense; GGAACGCGTTCGTGATGCTACCAAT
>probe:Drosophila_2:1631513_at:728:439; Interrogation_Position=740; Antisense; GAGGCCCACAGCTTCGTCTACAAGA
>probe:Drosophila_2:1631513_at:199:213; Interrogation_Position=761; Antisense; AAGACCTCTCAGCAGGCAGTCAAGG
>probe:Drosophila_2:1631513_at:370:17; Interrogation_Position=854; Antisense; ATTTTTGTGCCTTATCTGATGTTTA
>probe:Drosophila_2:1631513_at:432:691; Interrogation_Position=877; Antisense; TATTGTGTTCAGTTCTGCGCTGCAA
>probe:Drosophila_2:1631513_at:24:717; Interrogation_Position=889; Antisense; TTCTGCGCTGCAAAACTCCTAAATG

Paste this into a BLAST search page for me
AGTGGCAGCATTTCAATGTCCGCTTTCAGGTGTGGCTTCTTCCGGCAAAGAATTTGGGTCTACTGGAACGCCTCTGAAAAGGACTTCTTAGTCGGCGACAGGCGACAAACTTACCGTGGCAGACATGGCAGACATCTTCGGGTCTTCAGAATGAAGCTCTGCCAGTACAACGTAAGAAGCAATTCCCCAAGGTGGCCAAGGGAACGCGTTCGTGATGCTACCAATGAGGCCCACAGCTTCGTCTACAAGAAAGACCTCTCAGCAGGCAGTCAAGGATTTTTGTGCCTTATCTGATGTTTATATTGTGTTCAGTTCTGCGCTGCAATTCTGCGCTGCAAAACTCCTAAATG

Full Affymetrix probeset data:

Annotations for 1631513_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720