FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631514_at:

>probe:Drosophila_2:1631514_at:397:159; Interrogation_Position=104; Antisense; ACAAGCAGTCATGTGAAGCGAAACT
>probe:Drosophila_2:1631514_at:313:65; Interrogation_Position=13; Antisense; ATGGGTCGTCGCAAGTCCAAACGCA
>probe:Drosophila_2:1631514_at:631:371; Interrogation_Position=149; Antisense; GAAGAATTACCTGTACCGTGTGCCA
>probe:Drosophila_2:1631514_at:353:111; Interrogation_Position=151; Antisense; AGAATTACCTGTACCGTGTGCCAAG
>probe:Drosophila_2:1631514_at:332:151; Interrogation_Position=189; Antisense; ACATATAAACTATCTCACGGAGGCA
>probe:Drosophila_2:1631514_at:477:147; Interrogation_Position=197; Antisense; ACTATCTCACGGAGGCAATTGATGT
>probe:Drosophila_2:1631514_at:235:437; Interrogation_Position=208; Antisense; GAGGCAATTGATGTGTTCAACGATT
>probe:Drosophila_2:1631514_at:657:253; Interrogation_Position=225; Antisense; CAACGATTGGATTGATGCTTGCGAG
>probe:Drosophila_2:1631514_at:676:603; Interrogation_Position=237; Antisense; TGATGCTTGCGAGGAGGAGAACTAA
>probe:Drosophila_2:1631514_at:466:505; Interrogation_Position=27; Antisense; GTCCAAACGCAAAGGAGCCCCAAGA
>probe:Drosophila_2:1631514_at:571:209; Interrogation_Position=52; Antisense; AAGAAAAATATTCAGCCGCTGCCCA
>probe:Drosophila_2:1631514_at:491:21; Interrogation_Position=59; Antisense; ATATTCAGCCGCTGCCCATTCTTTT
>probe:Drosophila_2:1631514_at:630:307; Interrogation_Position=74; Antisense; CCATTCTTTTCGATTGTCCATTCTG
>probe:Drosophila_2:1631514_at:375:5; Interrogation_Position=86; Antisense; ATTGTCCATTCTGCAATCACAAGCA

Paste this into a BLAST search page for me
ACAAGCAGTCATGTGAAGCGAAACTATGGGTCGTCGCAAGTCCAAACGCAGAAGAATTACCTGTACCGTGTGCCAAGAATTACCTGTACCGTGTGCCAAGACATATAAACTATCTCACGGAGGCAACTATCTCACGGAGGCAATTGATGTGAGGCAATTGATGTGTTCAACGATTCAACGATTGGATTGATGCTTGCGAGTGATGCTTGCGAGGAGGAGAACTAAGTCCAAACGCAAAGGAGCCCCAAGAAAGAAAAATATTCAGCCGCTGCCCAATATTCAGCCGCTGCCCATTCTTTTCCATTCTTTTCGATTGTCCATTCTGATTGTCCATTCTGCAATCACAAGCA

Full Affymetrix probeset data:

Annotations for 1631514_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720