FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631515_at:

>probe:Drosophila_2:1631515_at:351:585; Interrogation_Position=1306; Antisense; TGGAAAACCTACTAGCCATCCTCGA
>probe:Drosophila_2:1631515_at:616:325; Interrogation_Position=1342; Antisense; GCGACTTGGGTCGATATGGCCATCT
>probe:Drosophila_2:1631515_at:312:557; Interrogation_Position=1367; Antisense; GGACGTGAACAATGCACCACTCATG
>probe:Drosophila_2:1631515_at:302:219; Interrogation_Position=1392; Antisense; AAGTCAGTGGACTCCCTACTAATCG
>probe:Drosophila_2:1631515_at:420:43; Interrogation_Position=1419; Antisense; ATCGAGACCGCCACGGAATCGGAGT
>probe:Drosophila_2:1631515_at:76:557; Interrogation_Position=1448; Antisense; GGACGAAAACTCTCTGCGCATGGAC
>probe:Drosophila_2:1631515_at:452:289; Interrogation_Position=1504; Antisense; CGGAGCTGGCGGATCCCAATCTGAT
>probe:Drosophila_2:1631515_at:71:607; Interrogation_Position=1602; Antisense; TGATCGCAGACCAACAGACGTCCGA
>probe:Drosophila_2:1631515_at:206:105; Interrogation_Position=1617; Antisense; AGACGTCCGATCTTTCGGCTATATC
>probe:Drosophila_2:1631515_at:32:425; Interrogation_Position=1647; Antisense; GAGACACGCGTGTTATCTTTTACAA
>probe:Drosophila_2:1631515_at:1:659; Interrogation_Position=1679; Antisense; TAAGTAATCGTTTCTGTGACAGCAC
>probe:Drosophila_2:1631515_at:68:103; Interrogation_Position=1699; Antisense; AGCACGTCGGTGTTTATCGGCAGTT
>probe:Drosophila_2:1631515_at:171:41; Interrogation_Position=1714; Antisense; ATCGGCAGTTGCTGGTTTTAGCGTT
>probe:Drosophila_2:1631515_at:233:705; Interrogation_Position=1731; Antisense; TTAGCGTTATCCTTTGGTTTACAGA

Paste this into a BLAST search page for me
TGGAAAACCTACTAGCCATCCTCGAGCGACTTGGGTCGATATGGCCATCTGGACGTGAACAATGCACCACTCATGAAGTCAGTGGACTCCCTACTAATCGATCGAGACCGCCACGGAATCGGAGTGGACGAAAACTCTCTGCGCATGGACCGGAGCTGGCGGATCCCAATCTGATTGATCGCAGACCAACAGACGTCCGAAGACGTCCGATCTTTCGGCTATATCGAGACACGCGTGTTATCTTTTACAATAAGTAATCGTTTCTGTGACAGCACAGCACGTCGGTGTTTATCGGCAGTTATCGGCAGTTGCTGGTTTTAGCGTTTTAGCGTTATCCTTTGGTTTACAGA

Full Affymetrix probeset data:

Annotations for 1631515_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720