FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631517_at:

>probe:Drosophila_2:1631517_at:29:419; Interrogation_Position=1877; Antisense; GAGCTCACCGACTACATTGTGGGAG
>probe:Drosophila_2:1631517_at:435:259; Interrogation_Position=1951; Antisense; CACCTCGGCACGTAACTTGTTGGGA
>probe:Drosophila_2:1631517_at:453:679; Interrogation_Position=2002; Antisense; TAGGTTGCGTCTTTCCGATAGCGTG
>probe:Drosophila_2:1631517_at:249:61; Interrogation_Position=2066; Antisense; ATGTCTAAGGACTCGCTCAACCAAA
>probe:Drosophila_2:1631517_at:631:19; Interrogation_Position=2112; Antisense; ACGTACCCAACACTTCGGATCGAAT
>probe:Drosophila_2:1631517_at:4:367; Interrogation_Position=2133; Antisense; GAATCTTTGCCATCGTTCGTGAACT
>probe:Drosophila_2:1631517_at:601:717; Interrogation_Position=2148; Antisense; TTCGTGAACTGGCTGGCTCTGGAAA
>probe:Drosophila_2:1631517_at:411:185; Interrogation_Position=2180; Antisense; AAAATCTCCGACATCATGGACCGCT
>probe:Drosophila_2:1631517_at:235:61; Interrogation_Position=2195; Antisense; ATGGACCGCTGCACAACCAAAGGAT
>probe:Drosophila_2:1631517_at:10:543; Interrogation_Position=2216; Antisense; GGATTCAAGCCCGACCAGGTGGACA
>probe:Drosophila_2:1631517_at:37:77; Interrogation_Position=2259; Antisense; AGGAGCTCAATGTCTGGCAGGTCAA
>probe:Drosophila_2:1631517_at:426:151; Interrogation_Position=2303; Antisense; ACATTCATGTAGATCGCACGCTTCA
>probe:Drosophila_2:1631517_at:520:275; Interrogation_Position=2323; Antisense; CTTCATCCCACATCTTACATTTAGT
>probe:Drosophila_2:1631517_at:298:61; Interrogation_Position=2358; Antisense; ATGTCTCTTTATCGCCAATCGTTAA

Paste this into a BLAST search page for me
GAGCTCACCGACTACATTGTGGGAGCACCTCGGCACGTAACTTGTTGGGATAGGTTGCGTCTTTCCGATAGCGTGATGTCTAAGGACTCGCTCAACCAAAACGTACCCAACACTTCGGATCGAATGAATCTTTGCCATCGTTCGTGAACTTTCGTGAACTGGCTGGCTCTGGAAAAAAATCTCCGACATCATGGACCGCTATGGACCGCTGCACAACCAAAGGATGGATTCAAGCCCGACCAGGTGGACAAGGAGCTCAATGTCTGGCAGGTCAAACATTCATGTAGATCGCACGCTTCACTTCATCCCACATCTTACATTTAGTATGTCTCTTTATCGCCAATCGTTAA

Full Affymetrix probeset data:

Annotations for 1631517_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720