FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631519_at:

>probe:Drosophila_2:1631519_at:146:419; Interrogation_Position=2228; Antisense; GAGCTGTTCGCGAGCGTGTGAATCT
>probe:Drosophila_2:1631519_at:242:615; Interrogation_Position=2246; Antisense; TGAATCTGGCGCGAGATCTGGACAA
>probe:Drosophila_2:1631519_at:519:307; Interrogation_Position=2392; Antisense; CCATTTGTGATTGAGCGACGTCGCA
>probe:Drosophila_2:1631519_at:28:239; Interrogation_Position=2416; Antisense; AATCGGCTGCGCGTGGAGACAGTTA
>probe:Drosophila_2:1631519_at:704:99; Interrogation_Position=2482; Antisense; AGAGGCTTCAGCTTCAAGTATCCCA
>probe:Drosophila_2:1631519_at:588:651; Interrogation_Position=2495; Antisense; TCAAGTATCCCAACAGCGAGGCGGC
>probe:Drosophila_2:1631519_at:606:71; Interrogation_Position=2513; Antisense; AGGCGGCCCAATTAGCCACGAGTCA
>probe:Drosophila_2:1631519_at:546:293; Interrogation_Position=2531; Antisense; CGAGTCATACTCAAAGTGCCGTGGA
>probe:Drosophila_2:1631519_at:228:55; Interrogation_Position=2560; Antisense; ATGAAGGCGGCCATAGAGGACCAGA
>probe:Drosophila_2:1631519_at:320:171; Interrogation_Position=2664; Antisense; AAAGCTATAGCCTTGGATGTTTCCA
>probe:Drosophila_2:1631519_at:513:547; Interrogation_Position=2678; Antisense; GGATGTTTCCATCAATGCTTTGAAA
>probe:Drosophila_2:1631519_at:584:389; Interrogation_Position=2699; Antisense; GAAACAAAGTATCGCACACCTCCAT
>probe:Drosophila_2:1631519_at:350:157; Interrogation_Position=2714; Antisense; ACACCTCCATCGGTCAATGAGCGAG
>probe:Drosophila_2:1631519_at:623:231; Interrogation_Position=2729; Antisense; AATGAGCGAGCGTGCTTGGCCAATA

Paste this into a BLAST search page for me
GAGCTGTTCGCGAGCGTGTGAATCTTGAATCTGGCGCGAGATCTGGACAACCATTTGTGATTGAGCGACGTCGCAAATCGGCTGCGCGTGGAGACAGTTAAGAGGCTTCAGCTTCAAGTATCCCATCAAGTATCCCAACAGCGAGGCGGCAGGCGGCCCAATTAGCCACGAGTCACGAGTCATACTCAAAGTGCCGTGGAATGAAGGCGGCCATAGAGGACCAGAAAAGCTATAGCCTTGGATGTTTCCAGGATGTTTCCATCAATGCTTTGAAAGAAACAAAGTATCGCACACCTCCATACACCTCCATCGGTCAATGAGCGAGAATGAGCGAGCGTGCTTGGCCAATA

Full Affymetrix probeset data:

Annotations for 1631519_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720