FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631520_at:

>probe:Drosophila_2:1631520_at:499:575; Interrogation_Position=4659; Antisense; GGCGAATTTCCAATTTGCACTGCAA
>probe:Drosophila_2:1631520_at:44:245; Interrogation_Position=4692; Antisense; AATTTTCGTTTGTTGCCAAGCCAAG
>probe:Drosophila_2:1631520_at:56:127; Interrogation_Position=4710; Antisense; AGCCAAGTCACCAAGGATCGTTTAC
>probe:Drosophila_2:1631520_at:667:39; Interrogation_Position=4726; Antisense; ATCGTTTACCCCAATACCATTATGT
>probe:Drosophila_2:1631520_at:504:385; Interrogation_Position=4783; Antisense; GAAATCGTTGGAGGATCCTTACCCT
>probe:Drosophila_2:1631520_at:111:547; Interrogation_Position=4795; Antisense; GGATCCTTACCCTTGTACATTATTT
>probe:Drosophila_2:1631520_at:53:21; Interrogation_Position=4816; Antisense; ATTTGGCTTTTGAGACTTCGATTGT
>probe:Drosophila_2:1631520_at:162:487; Interrogation_Position=4851; Antisense; GTAGATCCAGGAATCGCTCGAACTA
>probe:Drosophila_2:1631520_at:105:203; Interrogation_Position=4894; Antisense; AACCTCAAGACGATTCACGCGAAAT
>probe:Drosophila_2:1631520_at:453:91; Interrogation_Position=4941; Antisense; AGTTTTAAGCTCTCCTACTGTTAAG
>probe:Drosophila_2:1631520_at:315:359; Interrogation_Position=5010; Antisense; GCAAGCAGTCGCCTCAAGTTAAAGT
>probe:Drosophila_2:1631520_at:299:501; Interrogation_Position=5033; Antisense; GTCGTGTAAAAACTAGCCGCTATAT
>probe:Drosophila_2:1631520_at:153:597; Interrogation_Position=5122; Antisense; TGTGTGCGCGTGAGTCTCCATAAAT
>probe:Drosophila_2:1631520_at:550:515; Interrogation_Position=5170; Antisense; GTGTACGTCTTGATTTCCACATGAA

Paste this into a BLAST search page for me
GGCGAATTTCCAATTTGCACTGCAAAATTTTCGTTTGTTGCCAAGCCAAGAGCCAAGTCACCAAGGATCGTTTACATCGTTTACCCCAATACCATTATGTGAAATCGTTGGAGGATCCTTACCCTGGATCCTTACCCTTGTACATTATTTATTTGGCTTTTGAGACTTCGATTGTGTAGATCCAGGAATCGCTCGAACTAAACCTCAAGACGATTCACGCGAAATAGTTTTAAGCTCTCCTACTGTTAAGGCAAGCAGTCGCCTCAAGTTAAAGTGTCGTGTAAAAACTAGCCGCTATATTGTGTGCGCGTGAGTCTCCATAAATGTGTACGTCTTGATTTCCACATGAA

Full Affymetrix probeset data:

Annotations for 1631520_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720