FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631521_at:

>probe:Drosophila_2:1631521_at:715:725; Interrogation_Position=122; Antisense; TTGACGAACCAAATGTCGCTGCCCA
>probe:Drosophila_2:1631521_at:340:59; Interrogation_Position=134; Antisense; ATGTCGCTGCCCAAAAACGGTGGTA
>probe:Drosophila_2:1631521_at:657:139; Interrogation_Position=150; Antisense; ACGGTGGTACATTTATTATGGCCTT
>probe:Drosophila_2:1631521_at:631:243; Interrogation_Position=240; Antisense; AATATTTCAGATCGCCACATTCAGC
>probe:Drosophila_2:1631521_at:508:149; Interrogation_Position=256; Antisense; ACATTCAGCGGAGTGGGATTTCATA
>probe:Drosophila_2:1631521_at:514:517; Interrogation_Position=268; Antisense; GTGGGATTTCATAAAGTCGTCAGAG
>probe:Drosophila_2:1631521_at:327:557; Interrogation_Position=27; Antisense; GGAAAAGTACTGGAGACGTCTATTT
>probe:Drosophila_2:1631521_at:563:351; Interrogation_Position=323; Antisense; GCAGAAATCAATTGGAAGCTCCACT
>probe:Drosophila_2:1631521_at:419:509; Interrogation_Position=376; Antisense; GTGAAAACTGTTTCGGACTTGCATA
>probe:Drosophila_2:1631521_at:13:687; Interrogation_Position=427; Antisense; TATATAATGATACAACACGCCTGGT
>probe:Drosophila_2:1631521_at:430:187; Interrogation_Position=440; Antisense; AACACGCCTGGTTTGAGCGGTATAA
>probe:Drosophila_2:1631521_at:181:657; Interrogation_Position=462; Antisense; TAATGATCAAAAACCACCTCCTGCT
>probe:Drosophila_2:1631521_at:106:89; Interrogation_Position=59; Antisense; AGTCAGTTGCAGAACCTACGTCGTT
>probe:Drosophila_2:1631521_at:294:203; Interrogation_Position=71; Antisense; AACCTACGTCGTTGGATGCTGATAC

Paste this into a BLAST search page for me
TTGACGAACCAAATGTCGCTGCCCAATGTCGCTGCCCAAAAACGGTGGTAACGGTGGTACATTTATTATGGCCTTAATATTTCAGATCGCCACATTCAGCACATTCAGCGGAGTGGGATTTCATAGTGGGATTTCATAAAGTCGTCAGAGGGAAAAGTACTGGAGACGTCTATTTGCAGAAATCAATTGGAAGCTCCACTGTGAAAACTGTTTCGGACTTGCATATATATAATGATACAACACGCCTGGTAACACGCCTGGTTTGAGCGGTATAATAATGATCAAAAACCACCTCCTGCTAGTCAGTTGCAGAACCTACGTCGTTAACCTACGTCGTTGGATGCTGATAC

Full Affymetrix probeset data:

Annotations for 1631521_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720