Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631522_x_at:

>probe:Drosophila_2:1631522_x_at:337:67; Interrogation_Position=101; Antisense; ATGGCTTCGAAGGTCCTGGCAGTGA
>probe:Drosophila_2:1631522_x_at:468:223; Interrogation_Position=110; Antisense; AAGGTCCTGGCAGTGAGTCCGTCAA
>probe:Drosophila_2:1631522_x_at:439:287; Interrogation_Position=116; Antisense; CTGGCAGTGAGTCCGTCAACCCATC
>probe:Drosophila_2:1631522_x_at:304:513; Interrogation_Position=122; Antisense; GTGAGTCCGTCAACCCATCCGACGA
>probe:Drosophila_2:1631522_x_at:298:55; Interrogation_Position=13; Antisense; ATGAAGTTCTTGCTCCTGAGCGTCT
>probe:Drosophila_2:1631522_x_at:95:217; Interrogation_Position=16; Antisense; AAGTTCTTGCTCCTGAGCGTCTTCC
>probe:Drosophila_2:1631522_x_at:295:653; Interrogation_Position=176; Antisense; TCAAGAAGCTGCTGTTCCTGGGCTA
>probe:Drosophila_2:1631522_x_at:318:609; Interrogation_Position=29; Antisense; TGAGCGTCTTCCTTTGCCTTGCCGT
>probe:Drosophila_2:1631522_x_at:550:277; Interrogation_Position=40; Antisense; CTTTGCCTTGCCGTGTGCTTCATGG
>probe:Drosophila_2:1631522_x_at:547:721; Interrogation_Position=47; Antisense; TTGCCGTGTGCTTCATGGCCACCAG
>probe:Drosophila_2:1631522_x_at:560:291; Interrogation_Position=51; Antisense; CGTGTGCTTCATGGCCACCAGTGCT
>probe:Drosophila_2:1631522_x_at:379:261; Interrogation_Position=66; Antisense; CACCAGTGCTGCTCCTCGCGAGGAG
>probe:Drosophila_2:1631522_x_at:704:293; Interrogation_Position=84; Antisense; CGAGGAGGCCATTCCCGATGGCTTC
>probe:Drosophila_2:1631522_x_at:228:11; Interrogation_Position=94; Antisense; ATTCCCGATGGCTTCGAAGGTCCTG

Paste this into a BLAST search page for me
ATGGCTTCGAAGGTCCTGGCAGTGAAAGGTCCTGGCAGTGAGTCCGTCAACTGGCAGTGAGTCCGTCAACCCATCGTGAGTCCGTCAACCCATCCGACGAATGAAGTTCTTGCTCCTGAGCGTCTAAGTTCTTGCTCCTGAGCGTCTTCCTCAAGAAGCTGCTGTTCCTGGGCTATGAGCGTCTTCCTTTGCCTTGCCGTCTTTGCCTTGCCGTGTGCTTCATGGTTGCCGTGTGCTTCATGGCCACCAGCGTGTGCTTCATGGCCACCAGTGCTCACCAGTGCTGCTCCTCGCGAGGAGCGAGGAGGCCATTCCCGATGGCTTCATTCCCGATGGCTTCGAAGGTCCTG

Full Affymetrix probeset data:

Annotations for 1631522_x_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime