Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631523_at:

>probe:Drosophila_2:1631523_at:185:135; Interrogation_Position=1300; Antisense; ACGCAACTAACGCACTTCTATATTC
>probe:Drosophila_2:1631523_at:60:563; Interrogation_Position=1337; Antisense; GGAACTGCTTCAGCCTGAGAAACAT
>probe:Drosophila_2:1631523_at:501:229; Interrogation_Position=1362; Antisense; AATGGATGTGCTCATTCGTGCCAAT
>probe:Drosophila_2:1631523_at:641:505; Interrogation_Position=1379; Antisense; GTGCCAATGGCATTGCCTATACCGT
>probe:Drosophila_2:1631523_at:499:277; Interrogation_Position=1437; Antisense; CTTTCACGGAATAGCCTGCATGTAT
>probe:Drosophila_2:1631523_at:115:285; Interrogation_Position=1452; Antisense; CTGCATGTATCGCTTGCCCGAAAAA
>probe:Drosophila_2:1631523_at:440:171; Interrogation_Position=1474; Antisense; AAAGAGGGTGTGGACTCCTCCTCCT
>probe:Drosophila_2:1631523_at:465:393; Interrogation_Position=1504; Antisense; GAAATCTCCGCCAGCGTAGAGTCCT
>probe:Drosophila_2:1631523_at:207:431; Interrogation_Position=1522; Antisense; GAGTCCTCGCCCATAACAAGTAGTT
>probe:Drosophila_2:1631523_at:668:251; Interrogation_Position=1538; Antisense; CAAGTAGTTCTGATCCCAGCGAGGT
>probe:Drosophila_2:1631523_at:310:517; Interrogation_Position=1591; Antisense; GTGGTGCAGCACTTTGATTCCAAGT
>probe:Drosophila_2:1631523_at:588:245; Interrogation_Position=1656; Antisense; AATTCAGGCCTTTGAAGTGCTCAAC
>probe:Drosophila_2:1631523_at:586:509; Interrogation_Position=1699; Antisense; GTGACCTTGTCCGTTTGAAGTTGTT
>probe:Drosophila_2:1631523_at:373:69; Interrogation_Position=1728; Antisense; ATGGCCCATTTTTTATGTGATCACT

Paste this into a BLAST search page for me
ACGCAACTAACGCACTTCTATATTCGGAACTGCTTCAGCCTGAGAAACATAATGGATGTGCTCATTCGTGCCAATGTGCCAATGGCATTGCCTATACCGTCTTTCACGGAATAGCCTGCATGTATCTGCATGTATCGCTTGCCCGAAAAAAAAGAGGGTGTGGACTCCTCCTCCTGAAATCTCCGCCAGCGTAGAGTCCTGAGTCCTCGCCCATAACAAGTAGTTCAAGTAGTTCTGATCCCAGCGAGGTGTGGTGCAGCACTTTGATTCCAAGTAATTCAGGCCTTTGAAGTGCTCAACGTGACCTTGTCCGTTTGAAGTTGTTATGGCCCATTTTTTATGTGATCACT

Full Affymetrix probeset data:

Annotations for 1631523_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime