Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631525_at:

>probe:Drosophila_2:1631525_at:369:479; Interrogation_Position=122; Antisense; GTTTGGCGCCCTTCAAGAAACTCGG
>probe:Drosophila_2:1631525_at:228:107; Interrogation_Position=137; Antisense; AGAAACTCGGCGTTCTCGTGGACAT
>probe:Drosophila_2:1631525_at:214:369; Interrogation_Position=244; Antisense; GAATGCCGAAAAATGCTGCCCACTG
>probe:Drosophila_2:1631525_at:13:671; Interrogation_Position=275; Antisense; TACTGGATCTGCACATCACCGAACA
>probe:Drosophila_2:1631525_at:286:113; Interrogation_Position=299; Antisense; AGCACGATTGCTATTTTGCCGCCAG
>probe:Drosophila_2:1631525_at:188:417; Interrogation_Position=328; Antisense; GAGCGCGGTGACAAGCCCATGTTTT
>probe:Drosophila_2:1631525_at:562:307; Interrogation_Position=344; Antisense; CCATGTTTTCCTGCTTTCTGGAAGA
>probe:Drosophila_2:1631525_at:418:433; Interrogation_Position=367; Antisense; GAGTGCACCATCAAGTTTCATACTG
>probe:Drosophila_2:1631525_at:66:619; Interrogation_Position=412; Antisense; TGCATCATAACGCACAAGCTTCCGG
>probe:Drosophila_2:1631525_at:272:115; Interrogation_Position=428; Antisense; AGCTTCCGGCAAACTATCGCTTTGA
>probe:Drosophila_2:1631525_at:447:227; Interrogation_Position=556; Antisense; AAGGCCTTCAGCTTTGGACATCAAA
>probe:Drosophila_2:1631525_at:398:199; Interrogation_Position=579; Antisense; AACGCAGAGGAGTTTCTACACAGGC
>probe:Drosophila_2:1631525_at:300:439; Interrogation_Position=652; Antisense; GAGGCCATTAACGACATCCTGGATT
>probe:Drosophila_2:1631525_at:674:329; Interrogation_Position=85; Antisense; GCGGGATTCATAAAGCCCACGGATC

Paste this into a BLAST search page for me
GTTTGGCGCCCTTCAAGAAACTCGGAGAAACTCGGCGTTCTCGTGGACATGAATGCCGAAAAATGCTGCCCACTGTACTGGATCTGCACATCACCGAACAAGCACGATTGCTATTTTGCCGCCAGGAGCGCGGTGACAAGCCCATGTTTTCCATGTTTTCCTGCTTTCTGGAAGAGAGTGCACCATCAAGTTTCATACTGTGCATCATAACGCACAAGCTTCCGGAGCTTCCGGCAAACTATCGCTTTGAAAGGCCTTCAGCTTTGGACATCAAAAACGCAGAGGAGTTTCTACACAGGCGAGGCCATTAACGACATCCTGGATTGCGGGATTCATAAAGCCCACGGATC

Full Affymetrix probeset data:

Annotations for 1631525_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime