FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631527_at:

>probe:Drosophila_2:1631527_at:205:41; Interrogation_Position=1269; Antisense; ATCTGGAGGTCTTCAAGTCCTTCTT
>probe:Drosophila_2:1631527_at:606:119; Interrogation_Position=1333; Antisense; AGCTGTAGACGCACCCATGGACGAC
>probe:Drosophila_2:1631527_at:84:543; Interrogation_Position=1351; Antisense; GGACGACTACGTCAAGGACCCCATG
>probe:Drosophila_2:1631527_at:454:555; Interrogation_Position=1366; Antisense; GGACCCCATGGAACACCAGTTGCAG
>probe:Drosophila_2:1631527_at:116:609; Interrogation_Position=1470; Antisense; TGACCAAACTGGCATCTTTCATCGA
>probe:Drosophila_2:1631527_at:607:443; Interrogation_Position=1511; Antisense; GATGACGTGTCGAAGCTGCTGATTC
>probe:Drosophila_2:1631527_at:542:371; Interrogation_Position=1598; Antisense; GAAGGCACATTCAAGTCTGGCTCCG
>probe:Drosophila_2:1631527_at:284:427; Interrogation_Position=1622; Antisense; GAGTTGGACTTCTACATCGACGACG
>probe:Drosophila_2:1631527_at:616:409; Interrogation_Position=1643; Antisense; GACGACATGATCCACATAGCCGACA
>probe:Drosophila_2:1631527_at:137:673; Interrogation_Position=1659; Antisense; TAGCCGACACCAAGGTTTCACATCG
>probe:Drosophila_2:1631527_at:728:483; Interrogation_Position=1684; Antisense; GTATGGCGACTTCTTTGTGCGTAAA
>probe:Drosophila_2:1631527_at:297:271; Interrogation_Position=1747; Antisense; CATCAACATTTAAGCCGACTCCTTG
>probe:Drosophila_2:1631527_at:94:405; Interrogation_Position=1763; Antisense; GACTCCTTGTGACCCTTAATGATAA
>probe:Drosophila_2:1631527_at:4:453; Interrogation_Position=1842; Antisense; GATCTTGCGCAAGTTTGGTCCTCAA

Paste this into a BLAST search page for me
ATCTGGAGGTCTTCAAGTCCTTCTTAGCTGTAGACGCACCCATGGACGACGGACGACTACGTCAAGGACCCCATGGGACCCCATGGAACACCAGTTGCAGTGACCAAACTGGCATCTTTCATCGAGATGACGTGTCGAAGCTGCTGATTCGAAGGCACATTCAAGTCTGGCTCCGGAGTTGGACTTCTACATCGACGACGGACGACATGATCCACATAGCCGACATAGCCGACACCAAGGTTTCACATCGGTATGGCGACTTCTTTGTGCGTAAACATCAACATTTAAGCCGACTCCTTGGACTCCTTGTGACCCTTAATGATAAGATCTTGCGCAAGTTTGGTCCTCAA

Full Affymetrix probeset data:

Annotations for 1631527_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720