Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631529_at:

>probe:Drosophila_2:1631529_at:64:723; Interrogation_Position=156; Antisense; TTGCGGTGCAGTTATCTACAGTGAC
>probe:Drosophila_2:1631529_at:91:263; Interrogation_Position=197; Antisense; CAGCCCACTGTGTTGAAAGACCCTT
>probe:Drosophila_2:1631529_at:628:169; Interrogation_Position=212; Antisense; AAAGACCCTTCGATACACTGTATTC
>probe:Drosophila_2:1631529_at:153:483; Interrogation_Position=316; Antisense; GTATCTTCCACCATTTTGTTCAACG
>probe:Drosophila_2:1631529_at:436:559; Interrogation_Position=363; Antisense; GGACACTCTAATTTTCAATGCCGAA
>probe:Drosophila_2:1631529_at:699:215; Interrogation_Position=386; Antisense; AAGTAAGACCTATCCAACTGGCCGA
>probe:Drosophila_2:1631529_at:597:679; Interrogation_Position=411; Antisense; TAGTGCACCCGCAGCTGGAACTGAA
>probe:Drosophila_2:1631529_at:576:553; Interrogation_Position=427; Antisense; GGAACTGAAGCTTCGGTTTCTGGTT
>probe:Drosophila_2:1631529_at:173:393; Interrogation_Position=457; Antisense; GAAATCGGAATCCTCTGGCTACAAC
>probe:Drosophila_2:1631529_at:49:493; Interrogation_Position=530; Antisense; GTAAGCGGTCCTATCAGTACATCAC
>probe:Drosophila_2:1631529_at:442:95; Interrogation_Position=588; Antisense; AGATTCCTGTCATGGAGACTCCGGC
>probe:Drosophila_2:1631529_at:258:193; Interrogation_Position=635; Antisense; AACTAGTTGGCATTGTCTCCTACGG
>probe:Drosophila_2:1631529_at:644:693; Interrogation_Position=682; Antisense; TTTCCCGGAGTCTACGCCAATGTGG
>probe:Drosophila_2:1631529_at:11:523; Interrogation_Position=703; Antisense; GTGGCTGAGCTGAAACCTTGGATCT

Paste this into a BLAST search page for me
TTGCGGTGCAGTTATCTACAGTGACCAGCCCACTGTGTTGAAAGACCCTTAAAGACCCTTCGATACACTGTATTCGTATCTTCCACCATTTTGTTCAACGGGACACTCTAATTTTCAATGCCGAAAAGTAAGACCTATCCAACTGGCCGATAGTGCACCCGCAGCTGGAACTGAAGGAACTGAAGCTTCGGTTTCTGGTTGAAATCGGAATCCTCTGGCTACAACGTAAGCGGTCCTATCAGTACATCACAGATTCCTGTCATGGAGACTCCGGCAACTAGTTGGCATTGTCTCCTACGGTTTCCCGGAGTCTACGCCAATGTGGGTGGCTGAGCTGAAACCTTGGATCT

Full Affymetrix probeset data:

Annotations for 1631529_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime