Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631531_at:

>probe:Drosophila_2:1631531_at:540:177; Interrogation_Position=1633; Antisense; AAACGTTGACCACTGCTTCCGAAAT
>probe:Drosophila_2:1631531_at:685:511; Interrogation_Position=1683; Antisense; GTGATGTCAGCTAAGGCGGCCAAGA
>probe:Drosophila_2:1631531_at:81:375; Interrogation_Position=1706; Antisense; GAAGACTGCCAATACCAAGGTCGAA
>probe:Drosophila_2:1631531_at:690:221; Interrogation_Position=1813; Antisense; AAGTGGCTCCTGATCCAGAGCGCTG
>probe:Drosophila_2:1631531_at:337:217; Interrogation_Position=1845; Antisense; AAGTACGAGCGCACAGGCTTCCGAA
>probe:Drosophila_2:1631531_at:123:583; Interrogation_Position=1880; Antisense; TGGCGCTCGCGGCAAAGATGTCATT
>probe:Drosophila_2:1631531_at:445:171; Interrogation_Position=1893; Antisense; AAAGATGTCATTAAGGGCTCCCAGG
>probe:Drosophila_2:1631531_at:401:581; Interrogation_Position=1921; Antisense; TGGCCTCAGGAGCAGCCGATCAATA
>probe:Drosophila_2:1631531_at:714:241; Interrogation_Position=1942; Antisense; AATACGACATGTCCAGCCGCGTGAA
>probe:Drosophila_2:1631531_at:329:125; Interrogation_Position=1956; Antisense; AGCCGCGTGAATCTGACCAAGAACT
>probe:Drosophila_2:1631531_at:107:561; Interrogation_Position=2003; Antisense; GGAAACAGCTCCAGGTCCAAGGCAG
>probe:Drosophila_2:1631531_at:380:219; Interrogation_Position=2058; Antisense; AAGGGCGGTCGCTTCTAAACTGACA
>probe:Drosophila_2:1631531_at:453:195; Interrogation_Position=2075; Antisense; AACTGACACAGATCACATGCCTTTA
>probe:Drosophila_2:1631531_at:203:253; Interrogation_Position=2090; Antisense; CATGCCTTTATACTTTCGAACGCTG

Paste this into a BLAST search page for me
AAACGTTGACCACTGCTTCCGAAATGTGATGTCAGCTAAGGCGGCCAAGAGAAGACTGCCAATACCAAGGTCGAAAAGTGGCTCCTGATCCAGAGCGCTGAAGTACGAGCGCACAGGCTTCCGAATGGCGCTCGCGGCAAAGATGTCATTAAAGATGTCATTAAGGGCTCCCAGGTGGCCTCAGGAGCAGCCGATCAATAAATACGACATGTCCAGCCGCGTGAAAGCCGCGTGAATCTGACCAAGAACTGGAAACAGCTCCAGGTCCAAGGCAGAAGGGCGGTCGCTTCTAAACTGACAAACTGACACAGATCACATGCCTTTACATGCCTTTATACTTTCGAACGCTG

Full Affymetrix probeset data:

Annotations for 1631531_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime