Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631532_at:

>probe:Drosophila_2:1631532_at:141:97; Interrogation_Position=1041; Antisense; AGATTTCGATGCTCAGCGAGGCTGC
>probe:Drosophila_2:1631532_at:167:439; Interrogation_Position=1058; Antisense; GAGGCTGCCATGTTGGCTGTTTTGA
>probe:Drosophila_2:1631532_at:561:173; Interrogation_Position=1091; Antisense; AAAGCTCCTGTTTTACTCACGAATG
>probe:Drosophila_2:1631532_at:316:157; Interrogation_Position=1118; Antisense; ACACCGCTGTCCATGTGCAATAGCA
>probe:Drosophila_2:1631532_at:325:505; Interrogation_Position=1169; Antisense; GTCCTCAGCCTATTGCCGGAAAATG
>probe:Drosophila_2:1631532_at:192:587; Interrogation_Position=1192; Antisense; TGGAGGCGTAATCTTGCTCAACCTG
>probe:Drosophila_2:1631532_at:633:337; Interrogation_Position=1207; Antisense; GCTCAACCTGGAGCGTTGTGGCGAT
>probe:Drosophila_2:1631532_at:652:439; Interrogation_Position=1250; Antisense; GAGGCCATCACTGCAATCAACTATG
>probe:Drosophila_2:1631532_at:245:193; Interrogation_Position=1268; Antisense; AACTATGTGCGCAAGGTAGCCGGAG
>probe:Drosophila_2:1631532_at:391:425; Interrogation_Position=1430; Antisense; GAGACCCTGAAGAATCGATTGCCCT
>probe:Drosophila_2:1631532_at:22:609; Interrogation_Position=1459; Antisense; TGAGGAGTGGATTCCGCACGAGTCC
>probe:Drosophila_2:1631532_at:481:431; Interrogation_Position=1478; Antisense; GAGTCCATCGAAAGCAATTCCTATT
>probe:Drosophila_2:1631532_at:552:689; Interrogation_Position=1499; Antisense; TATTGCCGATATCCCGAGTCTTAGA
>probe:Drosophila_2:1631532_at:65:405; Interrogation_Position=1540; Antisense; GACTCAAGCGATTGTTCTCACATAA

Paste this into a BLAST search page for me
AGATTTCGATGCTCAGCGAGGCTGCGAGGCTGCCATGTTGGCTGTTTTGAAAAGCTCCTGTTTTACTCACGAATGACACCGCTGTCCATGTGCAATAGCAGTCCTCAGCCTATTGCCGGAAAATGTGGAGGCGTAATCTTGCTCAACCTGGCTCAACCTGGAGCGTTGTGGCGATGAGGCCATCACTGCAATCAACTATGAACTATGTGCGCAAGGTAGCCGGAGGAGACCCTGAAGAATCGATTGCCCTTGAGGAGTGGATTCCGCACGAGTCCGAGTCCATCGAAAGCAATTCCTATTTATTGCCGATATCCCGAGTCTTAGAGACTCAAGCGATTGTTCTCACATAA

Full Affymetrix probeset data:

Annotations for 1631532_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime