FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631533_at:

>probe:Drosophila_2:1631533_at:686:23; Interrogation_Position=1143; Antisense; ATATGATTCCATGCAGGAGCTGCGG
>probe:Drosophila_2:1631533_at:189:419; Interrogation_Position=1159; Antisense; GAGCTGCGGTACATGGAACTGGTCA
>probe:Drosophila_2:1631533_at:99:591; Interrogation_Position=1178; Antisense; TGGTCATAGCAGAAACCCTTCGGAA
>probe:Drosophila_2:1631533_at:321:563; Interrogation_Position=1199; Antisense; GGAAGTATCCCATACTACCGCAGCT
>probe:Drosophila_2:1631533_at:666:127; Interrogation_Position=1251; Antisense; AGCCAAGGGCGATCGTCATTTCTAC
>probe:Drosophila_2:1631533_at:409:645; Interrogation_Position=1266; Antisense; TCATTTCTACATCGAGCCGGGTCAA
>probe:Drosophila_2:1631533_at:715:165; Interrogation_Position=1289; Antisense; AAATGCTACTGATACCGGTCTACGG
>probe:Drosophila_2:1631533_at:36:23; Interrogation_Position=1335; Antisense; ATATCCCGAGCCACATAAGTTCATC
>probe:Drosophila_2:1631533_at:528:149; Interrogation_Position=1347; Antisense; ACATAAGTTCATCCCGGAGCGCTTT
>probe:Drosophila_2:1631533_at:123:555; Interrogation_Position=1362; Antisense; GGAGCGCTTTCTGGCCGATCAACTG
>probe:Drosophila_2:1631533_at:229:167; Interrogation_Position=1460; Antisense; AAATGCAGACGACCATTGGCCTGGT
>probe:Drosophila_2:1631533_at:330:537; Interrogation_Position=1481; Antisense; TGGTCAGTCTGCTCCGAAACTTTCA
>probe:Drosophila_2:1631533_at:505:389; Interrogation_Position=1496; Antisense; GAAACTTTCACTTCAGCGTCTGTCC
>probe:Drosophila_2:1631533_at:131:509; Interrogation_Position=1623; Antisense; GTGCTGCTTATTAAATCGCTATCTG

Paste this into a BLAST search page for me
ATATGATTCCATGCAGGAGCTGCGGGAGCTGCGGTACATGGAACTGGTCATGGTCATAGCAGAAACCCTTCGGAAGGAAGTATCCCATACTACCGCAGCTAGCCAAGGGCGATCGTCATTTCTACTCATTTCTACATCGAGCCGGGTCAAAAATGCTACTGATACCGGTCTACGGATATCCCGAGCCACATAAGTTCATCACATAAGTTCATCCCGGAGCGCTTTGGAGCGCTTTCTGGCCGATCAACTGAAATGCAGACGACCATTGGCCTGGTTGGTCAGTCTGCTCCGAAACTTTCAGAAACTTTCACTTCAGCGTCTGTCCGTGCTGCTTATTAAATCGCTATCTG

Full Affymetrix probeset data:

Annotations for 1631533_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720