Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631534_at:

>probe:Drosophila_2:1631534_at:139:445; Interrogation_Position=4288; Antisense; GATGAGCGCAGTGCCAAGCTGTTGC
>probe:Drosophila_2:1631534_at:719:119; Interrogation_Position=4304; Antisense; AGCTGTTGCAGCGATACTATCTCAA
>probe:Drosophila_2:1631534_at:424:37; Interrogation_Position=4322; Antisense; ATCTCAATCACAATACGGCGCTGGT
>probe:Drosophila_2:1631534_at:76:289; Interrogation_Position=4337; Antisense; CGGCGCTGGTGAAGCTGCTCAAAAA
>probe:Drosophila_2:1631534_at:244:181; Interrogation_Position=4357; Antisense; AAAAAGCTGGGCTCGCGGCCAATAC
>probe:Drosophila_2:1631534_at:559:361; Interrogation_Position=4383; Antisense; GCAATGGCTCAAAGACGACCTGTCC
>probe:Drosophila_2:1631534_at:644:103; Interrogation_Position=4395; Antisense; AGACGACCTGTCCACGGGAACGTGA
>probe:Drosophila_2:1631534_at:424:515; Interrogation_Position=4454; Antisense; GTGTCGGCTCCATAGGAGGCACTAA
>probe:Drosophila_2:1631534_at:308:185; Interrogation_Position=4538; Antisense; AAAATGCGGAGAGCGCTCAGCGACG
>probe:Drosophila_2:1631534_at:717:409; Interrogation_Position=4559; Antisense; GACGACGGCGTCACAACTGACAGGA
>probe:Drosophila_2:1631534_at:270:165; Interrogation_Position=4610; Antisense; AAATCTATCACACTCGTTTCCAGTT
>probe:Drosophila_2:1631534_at:183:713; Interrogation_Position=4635; Antisense; TTCACTTTTGGCAAGCTTCTGCAAA
>probe:Drosophila_2:1631534_at:416:565; Interrogation_Position=4762; Antisense; GGCAACTCTGTTTTCTATTTCCAAT
>probe:Drosophila_2:1631534_at:275:515; Interrogation_Position=4834; Antisense; GTGTAGCTTTTGCAGACTCTTGTCA

Paste this into a BLAST search page for me
GATGAGCGCAGTGCCAAGCTGTTGCAGCTGTTGCAGCGATACTATCTCAAATCTCAATCACAATACGGCGCTGGTCGGCGCTGGTGAAGCTGCTCAAAAAAAAAAGCTGGGCTCGCGGCCAATACGCAATGGCTCAAAGACGACCTGTCCAGACGACCTGTCCACGGGAACGTGAGTGTCGGCTCCATAGGAGGCACTAAAAAATGCGGAGAGCGCTCAGCGACGGACGACGGCGTCACAACTGACAGGAAAATCTATCACACTCGTTTCCAGTTTTCACTTTTGGCAAGCTTCTGCAAAGGCAACTCTGTTTTCTATTTCCAATGTGTAGCTTTTGCAGACTCTTGTCA

Full Affymetrix probeset data:

Annotations for 1631534_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime