FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631535_at:

>probe:Drosophila_2:1631535_at:194:603; Interrogation_Position=3368; Antisense; TGTTAATCCCTAATCGGTTCCATCT
>probe:Drosophila_2:1631535_at:651:39; Interrogation_Position=3380; Antisense; ATCGGTTCCATCTGAACGCCAGTTA
>probe:Drosophila_2:1631535_at:56:135; Interrogation_Position=3395; Antisense; ACGCCAGTTATGTAAGTGCCTGCAA
>probe:Drosophila_2:1631535_at:196:507; Interrogation_Position=3431; Antisense; GTGCTCCAAGAACTTGTGCTCATGT
>probe:Drosophila_2:1631535_at:268:261; Interrogation_Position=3504; Antisense; CACCCGATCCTATGCTGATTTTGTT
>probe:Drosophila_2:1631535_at:330:229; Interrogation_Position=3676; Antisense; AATGGGCTTGCGCTCCAAGGAATCT
>probe:Drosophila_2:1631535_at:662:225; Interrogation_Position=3692; Antisense; AAGGAATCTAGAATCGCCCCTCCAT
>probe:Drosophila_2:1631535_at:116:321; Interrogation_Position=3707; Antisense; GCCCCTCCATCGTATTTGTAGTGTA
>probe:Drosophila_2:1631535_at:639:375; Interrogation_Position=3738; Antisense; GAAGCATTTATCGAAGCCCTTGTTT
>probe:Drosophila_2:1631535_at:74:205; Interrogation_Position=3751; Antisense; AAGCCCTTGTTTGCGTTTCAGAGTC
>probe:Drosophila_2:1631535_at:549:265; Interrogation_Position=3769; Antisense; CAGAGTCCAGTTTATGTTCGAAATC
>probe:Drosophila_2:1631535_at:454:289; Interrogation_Position=3813; Antisense; CGGATGCGCGAAGCCCAAGTTTTAA
>probe:Drosophila_2:1631535_at:15:711; Interrogation_Position=3834; Antisense; TTAACCCAAAACGATGTGTGTCATG
>probe:Drosophila_2:1631535_at:505:255; Interrogation_Position=3924; Antisense; CGTTGAACTTAATGTGACCCACTTG

Paste this into a BLAST search page for me
TGTTAATCCCTAATCGGTTCCATCTATCGGTTCCATCTGAACGCCAGTTAACGCCAGTTATGTAAGTGCCTGCAAGTGCTCCAAGAACTTGTGCTCATGTCACCCGATCCTATGCTGATTTTGTTAATGGGCTTGCGCTCCAAGGAATCTAAGGAATCTAGAATCGCCCCTCCATGCCCCTCCATCGTATTTGTAGTGTAGAAGCATTTATCGAAGCCCTTGTTTAAGCCCTTGTTTGCGTTTCAGAGTCCAGAGTCCAGTTTATGTTCGAAATCCGGATGCGCGAAGCCCAAGTTTTAATTAACCCAAAACGATGTGTGTCATGCGTTGAACTTAATGTGACCCACTTG

Full Affymetrix probeset data:

Annotations for 1631535_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720