FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631536_at:

>probe:Drosophila_2:1631536_at:154:105; Interrogation_Position=1015; Antisense; AGACGCGCATTACCCAGCGATTTTC
>probe:Drosophila_2:1631536_at:264:123; Interrogation_Position=1030; Antisense; AGCGATTTTCTGACCAATCCCTTCA
>probe:Drosophila_2:1631536_at:83:713; Interrogation_Position=1079; Antisense; TTCAGACCCAAGTGACGTCGTCCTT
>probe:Drosophila_2:1631536_at:671:669; Interrogation_Position=1123; Antisense; TACTGCCTATCGCTGGTGGACACAC
>probe:Drosophila_2:1631536_at:236:397; Interrogation_Position=1141; Antisense; GACACACTGCGCAGCATGCGGAGAT
>probe:Drosophila_2:1631536_at:641:527; Interrogation_Position=1178; Antisense; GGGTCAAGTTCGAGTTCGCCAACAT
>probe:Drosophila_2:1631536_at:113:339; Interrogation_Position=1232; Antisense; GCTAAGGCGTCATAGTCATCATTCT
>probe:Drosophila_2:1631536_at:458:589; Interrogation_Position=1287; Antisense; TGGTAGACAACGCACTCGAACACTT
>probe:Drosophila_2:1631536_at:71:633; Interrogation_Position=1364; Antisense; TCTACGTTTCGAGTCCTAGGCTAAG
>probe:Drosophila_2:1631536_at:167:515; Interrogation_Position=1414; Antisense; GTGTCCATAGTCCATATCTCTTTAG
>probe:Drosophila_2:1631536_at:414:581; Interrogation_Position=900; Antisense; TGGCCAGGAGGTGCATCTAGAACAG
>probe:Drosophila_2:1631536_at:52:365; Interrogation_Position=954; Antisense; GAATAGCTCGCTGTCCAACGGAGAA
>probe:Drosophila_2:1631536_at:641:549; Interrogation_Position=973; Antisense; GGAGAAGTGACCATTGAGCCCATTT
>probe:Drosophila_2:1631536_at:235:5; Interrogation_Position=985; Antisense; ATTGAGCCCATTTACAAGCCTGCGG

Paste this into a BLAST search page for me
AGACGCGCATTACCCAGCGATTTTCAGCGATTTTCTGACCAATCCCTTCATTCAGACCCAAGTGACGTCGTCCTTTACTGCCTATCGCTGGTGGACACACGACACACTGCGCAGCATGCGGAGATGGGTCAAGTTCGAGTTCGCCAACATGCTAAGGCGTCATAGTCATCATTCTTGGTAGACAACGCACTCGAACACTTTCTACGTTTCGAGTCCTAGGCTAAGGTGTCCATAGTCCATATCTCTTTAGTGGCCAGGAGGTGCATCTAGAACAGGAATAGCTCGCTGTCCAACGGAGAAGGAGAAGTGACCATTGAGCCCATTTATTGAGCCCATTTACAAGCCTGCGG

Full Affymetrix probeset data:

Annotations for 1631536_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720